Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234966017:

Variant ID: vg0234966017 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34966017
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.29, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AGCATCTTGACGAAGATAAAGAAGCACATTGAGCTACATTTCTGAACCAAAGTATCAGAACCGGTGGCTCTACCAGACGGGGCCCAATAAGCCAAGAACG[C/T]
TCACCTGATCTGCTTTGCGTCCAGGAACCCGCAGAGCTCAGAGGCACCTGCAACATCCACCCAAATTGCGACCTCAGTAGTCCTCAGTAGGTTGAGAAAC

Reverse complement sequence

GTTTCTCAACCTACTGAGGACTACTGAGGTCGCAATTTGGGTGGATGTTGCAGGTGCCTCTGAGCTCTGCGGGTTCCTGGACGCAAAGCAGATCAGGTGA[G/A]
CGTTCTTGGCTTATTGGGCCCCGTCTGGTAGAGCCACCGGTTCTGATACTTTGGTTCAGAAATGTAGCTCAATGTGCTTCTTTATCTTCGTCAAGATGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	47.20%	0.51%	0.02%	NA
All Indica	2759	40.00%	59.30%	0.65%	0.04%	NA
All Japonica	1512	84.00%	15.80%	0.20%	0.00%	NA
Aus	269	16.40%	83.30%	0.37%	0.00%	NA
Indica I	595	21.30%	78.00%	0.67%	0.00%	NA
Indica II	465	79.60%	20.40%	0.00%	0.00%	NA
Indica III	913	27.60%	71.70%	0.55%	0.11%	NA
Indica Intermediate	786	45.00%	53.80%	1.15%	0.00%	NA
Temperate Japonica	767	97.80%	2.10%	0.13%	0.00%	NA
Tropical Japonica	504	59.50%	40.10%	0.40%	0.00%	NA
Japonica Intermediate	241	91.30%	8.70%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	52.20%	45.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234966017	C -> T	LOC_Os02g57100.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:91.37; most accessible tissue: Minghui63 flag leaf, score: 96.971	N	N	N	N
vg0234966017	C -> T	LOC_Os02g57090.1	downstream_gene_variant ; 4409.0bp to feature; MODIFIER	silent_mutation	Average:91.37; most accessible tissue: Minghui63 flag leaf, score: 96.971	N	N	N	N
vg0234966017	C -> T	LOC_Os02g57110.1	downstream_gene_variant ; 1580.0bp to feature; MODIFIER	silent_mutation	Average:91.37; most accessible tissue: Minghui63 flag leaf, score: 96.971	N	N	N	N
vg0234966017	C -> T	LOC_Os02g57110.2	downstream_gene_variant ; 1582.0bp to feature; MODIFIER	silent_mutation	Average:91.37; most accessible tissue: Minghui63 flag leaf, score: 96.971	N	N	N	N
vg0234966017	C -> DEL	N	N	silent_mutation	Average:91.37; most accessible tissue: Minghui63 flag leaf, score: 96.971	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0234966017	C	T	-0.03	-0.03	-0.04	-0.02	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234966017	NA	2.50E-07	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.45E-08	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	4.42E-08	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.46E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	6.48E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.21E-08	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.89E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	2.06E-09	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.78E-08	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	1.32E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	8.20E-10	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	4.11E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234966017	NA	4.39E-08	mr1994_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251