\
| Variant ID: vg0234962638 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34962638 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )
TGTATTCAGTTTGTTGCATTATCAAAATTTGGTAGTAGTGTTTGTATCAAATTTGGTAAAATGGCAATGGCAAGAGTTGTTTGTTTAGTTTGTTACCCTA[A/T]
CAAAATTTTATAACATCAAAACAAAAATTTTGATCAAGCCCGAATTCACCATAGATGAACAGATGAAGAAAGAGTACTAGAGTCATCAGTTTATGGGGGA
TCCCCCATAAACTGATGACTCTAGTACTCTTTCTTCATCTGTTCATCTATGGTGAATTCGGGCTTGATCAAAATTTTTGTTTTGATGTTATAAAATTTTG[T/A]
TAGGGTAACAAACTAAACAAACAACTCTTGCCATTGCCATTTTACCAAATTTGATACAAACACTACTACCAAATTTTGATAATGCAACAAACTGAATACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 7.40% | 1.57% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 73.10% | 22.20% | 4.76% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 54.10% | 38.30% | 7.56% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 3.20% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 10.40% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234962638 | A -> T | LOC_Os02g57090.1 | downstream_gene_variant ; 1030.0bp to feature; MODIFIER | silent_mutation | Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0234962638 | A -> T | LOC_Os02g57100.1 | downstream_gene_variant ; 986.0bp to feature; MODIFIER | silent_mutation | Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0234962638 | A -> T | LOC_Os02g57110.1 | downstream_gene_variant ; 4959.0bp to feature; MODIFIER | silent_mutation | Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0234962638 | A -> T | LOC_Os02g57110.2 | downstream_gene_variant ; 4961.0bp to feature; MODIFIER | silent_mutation | Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| vg0234962638 | A -> T | LOC_Os02g57090-LOC_Os02g57100 | intergenic_region ; MODIFIER | silent_mutation | Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234962638 | NA | 9.39E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.01E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.78E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 3.64E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 9.05E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 7.21E-10 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.02E-12 | mr1182_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.42E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.12E-07 | mr1227_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 1.06E-10 | mr1282_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234962638 | NA | 3.03E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |