\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234962638:

Variant ID: vg0234962638 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34962638
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TGTATTCAGTTTGTTGCATTATCAAAATTTGGTAGTAGTGTTTGTATCAAATTTGGTAAAATGGCAATGGCAAGAGTTGTTTGTTTAGTTTGTTACCCTA[A/T]
CAAAATTTTATAACATCAAAACAAAAATTTTGATCAAGCCCGAATTCACCATAGATGAACAGATGAAGAAAGAGTACTAGAGTCATCAGTTTATGGGGGA

Reverse complement sequence

TCCCCCATAAACTGATGACTCTAGTACTCTTTCTTCATCTGTTCATCTATGGTGAATTCGGGCTTGATCAAAATTTTTGTTTTGATGTTATAAAATTTTG[T/A]
TAGGGTAACAAACTAAACAAACAACTCTTGCCATTGCCATTTTACCAAATTTGATACAAACACTACTACCAAATTTTGATAATGCAACAAACTGAATACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 7.40% 1.57% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 73.10% 22.20% 4.76% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 54.10% 38.30% 7.56% 0.00% NA
Tropical Japonica  504 95.60% 3.20% 1.19% 0.00% NA
Japonica Intermediate  241 86.30% 10.40% 3.32% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 11.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234962638 A -> T LOC_Os02g57090.1 downstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0234962638 A -> T LOC_Os02g57100.1 downstream_gene_variant ; 986.0bp to feature; MODIFIER silent_mutation Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0234962638 A -> T LOC_Os02g57110.1 downstream_gene_variant ; 4959.0bp to feature; MODIFIER silent_mutation Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0234962638 A -> T LOC_Os02g57110.2 downstream_gene_variant ; 4961.0bp to feature; MODIFIER silent_mutation Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N
vg0234962638 A -> T LOC_Os02g57090-LOC_Os02g57100 intergenic_region ; MODIFIER silent_mutation Average:59.67; most accessible tissue: Minghui63 panicle, score: 84.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234962638 NA 9.39E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.01E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.78E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 3.64E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 9.05E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 7.21E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.02E-12 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.42E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.12E-07 mr1227_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 1.06E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234962638 NA 3.03E-06 mr1282_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251