\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234952491:

Variant ID: vg0234952491 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34952491
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GATGATGGTGTTCGTTTCGACCTTCTACAATAAAAGATTAAGAATAGGTGAGTTACATATGTATATCGATGGTTTCAATCAAGGCGTTTGGTTTCTTTAC[C/T]
TTGAATGGTATTCATCAACGTAAAAGAAGATGTTAACAAAGGGACGAGGCATGGATTTTAGCGGGAAACCTAGGGCATTAATTGGTGACATGCTTTTTTT

Reverse complement sequence

AAAAAAAGCATGTCACCAATTAATGCCCTAGGTTTCCCGCTAAAATCCATGCCTCGTCCCTTTGTTAACATCTTCTTTTACGTTGATGAATACCATTCAA[G/A]
GTAAAGAAACCAAACGCCTTGATTGAAACCATCGATATACATATGTAACTCACCTATTCTTAATCTTTTATTGTAGAAGGTCGAAACGAACACCATCATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 41.80% 0.51% 0.17% NA
All Indica  2759 41.20% 57.80% 0.69% 0.29% NA
All Japonica  1512 87.30% 12.60% 0.13% 0.00% NA
Aus  269 48.30% 51.70% 0.00% 0.00% NA
Indica I  595 23.70% 75.80% 0.50% 0.00% NA
Indica II  465 79.80% 19.80% 0.43% 0.00% NA
Indica III  913 28.10% 70.90% 0.66% 0.33% NA
Indica Intermediate  786 46.70% 51.70% 1.02% 0.64% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 66.70% 32.90% 0.40% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 11.50% 1.04% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234952491 C -> T LOC_Os02g57080.1 upstream_gene_variant ; 482.0bp to feature; MODIFIER silent_mutation Average:62.68; most accessible tissue: Callus, score: 93.408 N N N N
vg0234952491 C -> T LOC_Os02g57080.2 upstream_gene_variant ; 488.0bp to feature; MODIFIER silent_mutation Average:62.68; most accessible tissue: Callus, score: 93.408 N N N N
vg0234952491 C -> T LOC_Os02g57080-LOC_Os02g57090 intergenic_region ; MODIFIER silent_mutation Average:62.68; most accessible tissue: Callus, score: 93.408 N N N N
vg0234952491 C -> DEL N N silent_mutation Average:62.68; most accessible tissue: Callus, score: 93.408 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234952491 C T -0.01 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234952491 NA 4.79E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 3.55E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 2.61E-07 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 3.88E-08 mr1274_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 1.27E-06 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 1.73E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 3.71E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 1.94E-07 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 8.90E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 1.05E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 2.44E-08 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 6.25E-07 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 7.97E-12 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 8.49E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234952491 NA 3.75E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251