\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234922136:

Variant ID: vg0234922136 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34922136
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTATATCGTGCTTAAAGAACATTTGACAATGAATCAAGTCACGGTAAAATAAATGACAATTACATAAACTTTTTGAATAAGACAAATGGGAAAAAAGT[T/G]
AACGGCGTCATACATTAAAATATAGAGGTAGTAGTTAAAAAAAAGAGTAAATTGCACCAACGTTACAACAACTGACAGGTCTGATATAGTAATAATGGCG

Reverse complement sequence

CGCCATTATTACTATATCAGACCTGTCAGTTGTTGTAACGTTGGTGCAATTTACTCTTTTTTTTAACTACTACCTCTATATTTTAATGTATGACGCCGTT[A/C]
ACTTTTTTCCCATTTGTCTTATTCAAAAAGTTTATGTAATTGTCATTTATTTTACCGTGACTTGATTCATTGTCAAATGTTCTTTAAGCACGATATAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 29.60% 29.10% 18.39% 22.89% NA
All Indica  2759 39.70% 1.60% 24.28% 34.51% NA
All Japonica  1512 8.10% 80.60% 4.50% 6.75% NA
Aus  269 48.70% 5.90% 39.03% 6.32% NA
Indica I  595 59.20% 0.80% 18.32% 21.68% NA
Indica II  465 19.10% 2.20% 19.57% 59.14% NA
Indica III  913 39.10% 1.60% 29.79% 29.46% NA
Indica Intermediate  786 37.70% 1.70% 25.19% 35.50% NA
Temperate Japonica  767 1.40% 92.00% 1.43% 5.08% NA
Tropical Japonica  504 20.00% 57.90% 10.52% 11.51% NA
Japonica Intermediate  241 4.60% 91.70% 1.66% 2.07% NA
VI/Aromatic  96 27.10% 64.60% 8.33% 0.00% NA
Intermediate  90 28.90% 38.90% 20.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234922136 T -> G LOC_Os02g56980.1 upstream_gene_variant ; 4150.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57010.1 upstream_gene_variant ; 365.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57020.1 upstream_gene_variant ; 3235.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57030.1 upstream_gene_variant ; 4500.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57030.2 upstream_gene_variant ; 4500.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g56990.1 downstream_gene_variant ; 1988.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57000.1 downstream_gene_variant ; 400.0bp to feature; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> G LOC_Os02g57000-LOC_Os02g57010 intergenic_region ; MODIFIER silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N
vg0234922136 T -> DEL N N silent_mutation Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234922136 NA 1.41E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234922136 NA 7.59E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 9.83E-06 1.56E-10 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 1.23E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 1.84E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 1.48E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 2.03E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 6.79E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 2.35E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 2.86E-17 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 2.03E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 9.74E-17 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 7.69E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 2.07E-07 3.11E-61 mr1526_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 3.04E-10 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 1.05E-20 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 6.62E-40 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136 NA 2.26E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251