Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234922136:

Variant ID: vg0234922136 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34922136
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTATATCGTGCTTAAAGAACATTTGACAATGAATCAAGTCACGGTAAAATAAATGACAATTACATAAACTTTTTGAATAAGACAAATGGGAAAAAAGT[T/G]
AACGGCGTCATACATTAAAATATAGAGGTAGTAGTTAAAAAAAAGAGTAAATTGCACCAACGTTACAACAACTGACAGGTCTGATATAGTAATAATGGCG

Reverse complement sequence

CGCCATTATTACTATATCAGACCTGTCAGTTGTTGTAACGTTGGTGCAATTTACTCTTTTTTTTAACTACTACCTCTATATTTTAATGTATGACGCCGTT[A/C]
ACTTTTTTCCCATTTGTCTTATTCAAAAAGTTTATGTAATTGTCATTTATTTTACCGTGACTTGATTCATTGTCAAATGTTCTTTAAGCACGATATAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.60%	29.10%	18.39%	22.89%	NA
All Indica	2759	39.70%	1.60%	24.28%	34.51%	NA
All Japonica	1512	8.10%	80.60%	4.50%	6.75%	NA
Aus	269	48.70%	5.90%	39.03%	6.32%	NA
Indica I	595	59.20%	0.80%	18.32%	21.68%	NA
Indica II	465	19.10%	2.20%	19.57%	59.14%	NA
Indica III	913	39.10%	1.60%	29.79%	29.46%	NA
Indica Intermediate	786	37.70%	1.70%	25.19%	35.50%	NA
Temperate Japonica	767	1.40%	92.00%	1.43%	5.08%	NA
Tropical Japonica	504	20.00%	57.90%	10.52%	11.51%	NA
Japonica Intermediate	241	4.60%	91.70%	1.66%	2.07%	NA
VI/Aromatic	96	27.10%	64.60%	8.33%	0.00%	NA
Intermediate	90	28.90%	38.90%	20.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234922136	T -> G	LOC_Os02g56980.1	upstream_gene_variant ; 4150.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57010.1	upstream_gene_variant ; 365.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57020.1	upstream_gene_variant ; 3235.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57030.1	upstream_gene_variant ; 4500.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57030.2	upstream_gene_variant ; 4500.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g56990.1	downstream_gene_variant ; 1988.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57000.1	downstream_gene_variant ; 400.0bp to feature; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> G	LOC_Os02g57000-LOC_Os02g57010	intergenic_region ; MODIFIER	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N
vg0234922136	T -> DEL	N	N	silent_mutation	Average:55.548; most accessible tissue: Zhenshan97 flag leaf, score: 72.757	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234922136	NA	1.41E-12	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234922136	NA	7.59E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	9.83E-06	1.56E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	1.23E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	1.84E-08	mr1302	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	1.48E-06	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	2.03E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	6.79E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	2.35E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	2.86E-17	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	2.03E-14	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	9.74E-17	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	7.69E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	2.07E-07	3.11E-61	mr1526_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	3.04E-10	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	1.05E-20	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	6.62E-40	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234922136	NA	2.26E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251