\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234921802:

Variant ID: vg0234921802 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34921802
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, C: 0.09, others allele: 0.00, population size: 163. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTCGATGGACAAATAAATAAGCAGGTTTACTAGCGGCATTTGGGTATAGATTAACTACAGCCTTATTATTTTCATTTTGTAAAAATTGCTGTTTTC[G/C]
AGCTGTTTTATGCTTACTTTTCAATAAACTGAATTATGCAAAAAGAAAAAACACCATGGTAATGGAGTGAGTTTTTTCCTGGATGTATTATTTTGAATGT

Reverse complement sequence

ACATTCAAAATAATACATCCAGGAAAAAACTCACTCCATTACCATGGTGTTTTTTCTTTTTGCATAATTCAGTTTATTGAAAAGTAAGCATAAAACAGCT[C/G]
GAAAACAGCAATTTTTACAAAATGAAAATAATAAGGCTGTAGTTAATCTATACCCAAATGCCGCTAGTAAACCTGCTTATTTATTTGTCCATCGAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 28.20% 0.08% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 19.90% 79.90% 0.20% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 8.20% 91.80% 0.00% 0.00% NA
Tropical Japonica  504 43.10% 56.30% 0.60% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234921802 G -> C LOC_Os02g56980.1 upstream_gene_variant ; 3816.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57010.1 upstream_gene_variant ; 699.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57020.1 upstream_gene_variant ; 3569.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57030.1 upstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57030.2 upstream_gene_variant ; 4834.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g56990.1 downstream_gene_variant ; 1654.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57000.1 downstream_gene_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N
vg0234921802 G -> C LOC_Os02g57000-LOC_Os02g57010 intergenic_region ; MODIFIER silent_mutation Average:51.854; most accessible tissue: Callus, score: 78.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234921802 NA 3.37E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0234921802 NA 2.35E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 5.96E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.29E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.42E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 5.69E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 8.96E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 5.69E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 8.30E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.20E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 6.19E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 7.29E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 2.73E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 5.27E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.86E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.58E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.46E-15 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 3.69E-16 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.09E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 5.76E-13 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 3.06E-07 6.60E-60 mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 3.51E-06 2.04E-11 mr1526_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 8.32E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 4.29E-42 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 8.58E-44 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.30E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234921802 NA 1.94E-16 mr1842_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251