Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234625806:

Variant ID: vg0234625806 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34625806
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTACTGACACAGCCAAATAAAGCAACCTGGCTAATGTGATCATCGCTAGTACAATAGCACTCCCTCCGTTTCAAAATGTTTGACACCGTTGACTTTTTAG[C/T]
ACATGTTTGACCGTTCATCTTATTCAAAACAATTTGTGAAATATGTAAAACTATATGTGTACATGAAAGTATATTTAACAATAAATCAAATGATATGAAA

Reverse complement sequence

TTTCATATCATTTGATTTATTGTTAAATATACTTTCATGTACACATATAGTTTTACATATTTCACAAATTGTTTTGAATAAGATGAACGGTCAAACATGT[G/A]
CTAAAAAGTCAACGGTGTCAAACATTTTGAAACGGAGGGAGTGCTATTGTACTAGCGATGATCACATTAGCCAGGTTGCTTTATTTGGCTGTGTCAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.30%	49.70%	0.02%	0.00%	NA
All Indica	2759	31.90%	68.00%	0.04%	0.00%	NA
All Japonica	1512	89.20%	10.80%	0.00%	0.00%	NA
Aus	269	15.20%	84.80%	0.00%	0.00%	NA
Indica I	595	25.40%	74.50%	0.17%	0.00%	NA
Indica II	465	75.70%	24.30%	0.00%	0.00%	NA
Indica III	913	14.70%	85.30%	0.00%	0.00%	NA
Indica Intermediate	786	31.00%	69.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.70%	1.30%	0.00%	0.00%	NA
Tropical Japonica	504	72.60%	27.40%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.60%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234625806	C -> T	LOC_Os02g56530.1	upstream_gene_variant ; 2141.0bp to feature; MODIFIER	silent_mutation	Average:54.045; most accessible tissue: Zhenshan97 root, score: 64.045	N	N	N	N
vg0234625806	C -> T	LOC_Os02g56530-LOC_Os02g56540	intergenic_region ; MODIFIER	silent_mutation	Average:54.045; most accessible tissue: Zhenshan97 root, score: 64.045	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234625806	NA	7.61E-10	mr1835	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	6.95E-06	mr1892	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	7.90E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	4.91E-06	mr1186_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.69E-07	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	4.12E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	5.45E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.57E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	6.10E-08	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.78E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	3.21E-06	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	8.38E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.03E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	7.35E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.57E-10	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	6.60E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	7.70E-10	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	1.99E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	1.34E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	4.37E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625806	NA	2.02E-07	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251