\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234625030:

Variant ID: vg0234625030 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34625030
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GCTCGTCACCCTTATCAATTGTATGCATATGCGCTCTTATAAGCAACTTCGAACGATTGAGACTAATAGACTTGAAATTAACGAAGTCACTATATCACAC[G/A]
TTGCCTGGCACCAAAAGAAAATCAGAAACTTGAACTTATGAGTTAGTGTAGCTAGTGCTGTGATATTGTGTACATGTGGGACGCATTTTTGTATTGGGGG

Reverse complement sequence

CCCCCAATACAAAAATGCGTCCCACATGTACACAATATCACAGCACTAGCTACACTAACTCATAAGTTCAAGTTTCTGATTTTCTTTTGGTGCCAGGCAA[C/T]
GTGTGATATAGTGACTTCGTTAATTTCAAGTCTATTAGTCTCAATCGTTCGAAGTTGCTTATAAGAGCGCATATGCATACAATTGATAAGGGTGACGAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.70% 0.06% 0.02% NA
All Indica  2759 68.20% 31.60% 0.11% 0.04% NA
All Japonica  1512 92.50% 7.50% 0.00% 0.00% NA
Aus  269 4.50% 95.50% 0.00% 0.00% NA
Indica I  595 76.50% 23.50% 0.00% 0.00% NA
Indica II  465 29.50% 70.30% 0.22% 0.00% NA
Indica III  913 83.10% 16.80% 0.11% 0.00% NA
Indica Intermediate  786 67.70% 32.10% 0.13% 0.13% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234625030 G -> A LOC_Os02g56530.1 upstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:67.82; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0234625030 G -> A LOC_Os02g56530-LOC_Os02g56540 intergenic_region ; MODIFIER silent_mutation Average:67.82; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0234625030 G -> DEL N N silent_mutation Average:67.82; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234625030 NA 2.77E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 4.57E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 8.92E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.51E-07 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 2.36E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 9.18E-10 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 2.99E-18 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.11E-08 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.80E-06 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 6.11E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.27E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.87E-11 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.21E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 2.40E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.29E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 2.63E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.63E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 5.23E-07 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.41E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.30E-09 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.69E-12 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 3.93E-07 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 1.57E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 6.02E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234625030 NA 2.62E-08 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251