\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234591868:

Variant ID: vg0234591868 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 34591868
Reference Allele: CAlternative Allele: T,CGG
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAAAAAAAGGATCAATATGATTTTTTAAAACAACTTTCGTATAGAAACTTTTTACAGAATAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCGCG[C/T,CGG]
AGAATACAAGAGAGAGGGTTGGGAACACCGAGCAAAGAACATAGGCTAAGGCCATTCACACTGCACCTAGGTGTCATTCCCCTTCACCTAGGCATAGCTC

Reverse complement sequence

GAGCTATGCCTAGGTGAAGGGGAATGACACCTAGGTGCAGTGTGAATGGCCTTAGCCTATGTTCTTTGCTCGGTGTTCCCAACCCTCTCTCTTGTATTCT[G/A,CCG]
CGCGCACGCTTTTCAAACTGCTAAACGGTGTGTTTTATTCTGTAAAAAGTTTCTATACGAAAGTTGTTTTAAAAAATCATATTGATCCTTTTTTTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.10% 43.80% 0.17% 0.00% NA
All Indica  2759 28.70% 71.00% 0.29% 0.00% NA
All Japonica  1512 94.90% 5.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 39.30% 60.20% 0.50% 0.00% NA
Indica II  465 12.00% 88.00% 0.00% 0.00% NA
Indica III  913 30.30% 69.70% 0.00% 0.00% NA
Indica Intermediate  786 28.60% 70.70% 0.64% 0.00% NA
Temperate Japonica  767 92.40% 7.60% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234591868 C -> CGG LOC_Os02g56500.2 upstream_gene_variant ; 4769.0bp to feature; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> CGG LOC_Os02g56500.3 upstream_gene_variant ; 4238.0bp to feature; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> CGG LOC_Os02g56500.4 upstream_gene_variant ; 4445.0bp to feature; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> CGG LOC_Os02g56500.5 upstream_gene_variant ; 4448.0bp to feature; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> CGG LOC_Os02g56500.1 upstream_gene_variant ; 4769.0bp to feature; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> CGG LOC_Os02g56490-LOC_Os02g56500 intergenic_region ; MODIFIER N Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56500.2 upstream_gene_variant ; 4770.0bp to feature; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56500.3 upstream_gene_variant ; 4239.0bp to feature; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56500.4 upstream_gene_variant ; 4446.0bp to feature; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56500.5 upstream_gene_variant ; 4449.0bp to feature; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56500.1 upstream_gene_variant ; 4770.0bp to feature; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N
vg0234591868 C -> T LOC_Os02g56490-LOC_Os02g56500 intergenic_region ; MODIFIER silent_mutation Average:67.777; most accessible tissue: Zhenshan97 panicle, score: 92.533 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234591868 C CGG 0.07 0.07 0.08 -0.01 0.06 0.07
vg0234591868 C T -0.02 -0.02 -0.03 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234591868 NA 4.47E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 3.83E-08 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 3.82E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 6.39E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 6.10E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 4.87E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 2.52E-07 NA mr1221_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 5.23E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 3.49E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 8.98E-06 NA mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 2.45E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234591868 NA 5.57E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251