\
| Variant ID: vg0234501233 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34501233 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.44, others allele: 0.00, population size: 32. )
AAAACATGTTAGCTGATATTGTTTCTCTATGTTACAACAGGTGAGAGTGTTTAGGAAGAAAAAAAATGAATTATCATTTCTTATCAGTCATAGGATAGTA[C/T]
AGGGAAAACATGTACTTTGGGGAATCTATTATGGACAATAGTAAAGGGAGAGTTACTTTTAAAAGAATAAACCATAAACCATTTCCAATTTACCATTATT
AATAATGGTAAATTGGAAATGGTTTATGGTTTATTCTTTTAAAAGTAACTCTCCCTTTACTATTGTCCATAATAGATTCCCCAAAGTACATGTTTTCCCT[G/A]
TACTATCCTATGACTGATAAGAAATGATAATTCATTTTTTTTCTTCCTAAACACTCTCACCTGTTGTAACATAGAGAAACAATATCAGCTAACATGTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.30% | 31.90% | 4.93% | 4.91% | NA |
| All Indica | 2759 | 90.40% | 3.40% | 4.93% | 1.23% | NA |
| All Japonica | 1512 | 3.40% | 87.80% | 0.99% | 7.80% | NA |
| Aus | 269 | 58.00% | 15.60% | 20.45% | 5.95% | NA |
| Indica I | 595 | 96.60% | 0.70% | 2.52% | 0.17% | NA |
| Indica II | 465 | 93.10% | 1.30% | 4.30% | 1.29% | NA |
| Indica III | 913 | 84.00% | 7.40% | 7.23% | 1.31% | NA |
| Indica Intermediate | 786 | 91.50% | 2.20% | 4.45% | 1.91% | NA |
| Temperate Japonica | 767 | 3.00% | 92.60% | 0.91% | 3.52% | NA |
| Tropical Japonica | 504 | 3.60% | 79.00% | 1.39% | 16.07% | NA |
| Japonica Intermediate | 241 | 4.10% | 91.30% | 0.41% | 4.15% | NA |
| VI/Aromatic | 96 | 14.60% | 6.20% | 17.71% | 61.46% | NA |
| Intermediate | 90 | 42.20% | 41.10% | 11.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234501233 | C -> T | LOC_Os02g56354.1 | upstream_gene_variant ; 3116.0bp to feature; MODIFIER | silent_mutation | Average:21.844; most accessible tissue: Callus, score: 35.779 | N | N | N | N |
| vg0234501233 | C -> T | LOC_Os02g56360.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.844; most accessible tissue: Callus, score: 35.779 | N | N | N | N |
| vg0234501233 | C -> T | LOC_Os02g56360.3 | intron_variant ; MODIFIER | silent_mutation | Average:21.844; most accessible tissue: Callus, score: 35.779 | N | N | N | N |
| vg0234501233 | C -> DEL | N | N | silent_mutation | Average:21.844; most accessible tissue: Callus, score: 35.779 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234501233 | NA | 2.81E-32 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 1.69E-25 | mr1537 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 8.08E-20 | mr1541 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 9.35E-28 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 2.34E-11 | mr1657 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 3.24E-32 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 3.52E-23 | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 1.61E-42 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 4.98E-41 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234501233 | NA | 4.18E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |