Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234501233:

Variant ID: vg0234501233 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34501233
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.44, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACATGTTAGCTGATATTGTTTCTCTATGTTACAACAGGTGAGAGTGTTTAGGAAGAAAAAAAATGAATTATCATTTCTTATCAGTCATAGGATAGTA[C/T]
AGGGAAAACATGTACTTTGGGGAATCTATTATGGACAATAGTAAAGGGAGAGTTACTTTTAAAAGAATAAACCATAAACCATTTCCAATTTACCATTATT

Reverse complement sequence

AATAATGGTAAATTGGAAATGGTTTATGGTTTATTCTTTTAAAAGTAACTCTCCCTTTACTATTGTCCATAATAGATTCCCCAAAGTACATGTTTTCCCT[G/A]
TACTATCCTATGACTGATAAGAAATGATAATTCATTTTTTTTCTTCCTAAACACTCTCACCTGTTGTAACATAGAGAAACAATATCAGCTAACATGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	31.90%	4.93%	4.91%	NA
All Indica	2759	90.40%	3.40%	4.93%	1.23%	NA
All Japonica	1512	3.40%	87.80%	0.99%	7.80%	NA
Aus	269	58.00%	15.60%	20.45%	5.95%	NA
Indica I	595	96.60%	0.70%	2.52%	0.17%	NA
Indica II	465	93.10%	1.30%	4.30%	1.29%	NA
Indica III	913	84.00%	7.40%	7.23%	1.31%	NA
Indica Intermediate	786	91.50%	2.20%	4.45%	1.91%	NA
Temperate Japonica	767	3.00%	92.60%	0.91%	3.52%	NA
Tropical Japonica	504	3.60%	79.00%	1.39%	16.07%	NA
Japonica Intermediate	241	4.10%	91.30%	0.41%	4.15%	NA
VI/Aromatic	96	14.60%	6.20%	17.71%	61.46%	NA
Intermediate	90	42.20%	41.10%	11.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234501233	C -> T	LOC_Os02g56354.1	upstream_gene_variant ; 3116.0bp to feature; MODIFIER	silent_mutation	Average:21.844; most accessible tissue: Callus, score: 35.779	N	N	N	N
vg0234501233	C -> T	LOC_Os02g56360.1	intron_variant ; MODIFIER	silent_mutation	Average:21.844; most accessible tissue: Callus, score: 35.779	N	N	N	N
vg0234501233	C -> T	LOC_Os02g56360.3	intron_variant ; MODIFIER	silent_mutation	Average:21.844; most accessible tissue: Callus, score: 35.779	N	N	N	N
vg0234501233	C -> DEL	N	N	silent_mutation	Average:21.844; most accessible tissue: Callus, score: 35.779	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234501233	NA	2.81E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	1.69E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	8.08E-20	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	9.35E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	2.34E-11	mr1657	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	3.24E-32	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	3.52E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	1.61E-42	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	4.98E-41	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233	NA	4.18E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251