\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234501233:

Variant ID: vg0234501233 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34501233
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.44, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACATGTTAGCTGATATTGTTTCTCTATGTTACAACAGGTGAGAGTGTTTAGGAAGAAAAAAAATGAATTATCATTTCTTATCAGTCATAGGATAGTA[C/T]
AGGGAAAACATGTACTTTGGGGAATCTATTATGGACAATAGTAAAGGGAGAGTTACTTTTAAAAGAATAAACCATAAACCATTTCCAATTTACCATTATT

Reverse complement sequence

AATAATGGTAAATTGGAAATGGTTTATGGTTTATTCTTTTAAAAGTAACTCTCCCTTTACTATTGTCCATAATAGATTCCCCAAAGTACATGTTTTCCCT[G/A]
TACTATCCTATGACTGATAAGAAATGATAATTCATTTTTTTTCTTCCTAAACACTCTCACCTGTTGTAACATAGAGAAACAATATCAGCTAACATGTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 31.90% 4.93% 4.91% NA
All Indica  2759 90.40% 3.40% 4.93% 1.23% NA
All Japonica  1512 3.40% 87.80% 0.99% 7.80% NA
Aus  269 58.00% 15.60% 20.45% 5.95% NA
Indica I  595 96.60% 0.70% 2.52% 0.17% NA
Indica II  465 93.10% 1.30% 4.30% 1.29% NA
Indica III  913 84.00% 7.40% 7.23% 1.31% NA
Indica Intermediate  786 91.50% 2.20% 4.45% 1.91% NA
Temperate Japonica  767 3.00% 92.60% 0.91% 3.52% NA
Tropical Japonica  504 3.60% 79.00% 1.39% 16.07% NA
Japonica Intermediate  241 4.10% 91.30% 0.41% 4.15% NA
VI/Aromatic  96 14.60% 6.20% 17.71% 61.46% NA
Intermediate  90 42.20% 41.10% 11.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234501233 C -> T LOC_Os02g56354.1 upstream_gene_variant ; 3116.0bp to feature; MODIFIER silent_mutation Average:21.844; most accessible tissue: Callus, score: 35.779 N N N N
vg0234501233 C -> T LOC_Os02g56360.1 intron_variant ; MODIFIER silent_mutation Average:21.844; most accessible tissue: Callus, score: 35.779 N N N N
vg0234501233 C -> T LOC_Os02g56360.3 intron_variant ; MODIFIER silent_mutation Average:21.844; most accessible tissue: Callus, score: 35.779 N N N N
vg0234501233 C -> DEL N N silent_mutation Average:21.844; most accessible tissue: Callus, score: 35.779 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234501233 NA 2.81E-32 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 1.69E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 8.08E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 9.35E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 2.34E-11 mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 3.24E-32 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 3.52E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 1.61E-42 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 4.98E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234501233 NA 4.18E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251