\
| Variant ID: vg0234417843 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34417843 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 111. )
TATGTTTACATATAACATATTTTTATACAATATCTATTGTGCAAATGCTCCCTATATTAGGCCGATTACCATTTAATACTGAGGGCTTACTCTATTCTTT[T/C]
TGTATATATGACGCTTGTTTACGGTATACATAATACCCGATTCTTAATCCAAATATGCTCATTACATCCTGACAATACTAGAAGATTTATACAATTTTCT
AGAAAATTGTATAAATCTTCTAGTATTGTCAGGATGTAATGAGCATATTTGGATTAAGAATCGGGTATTATGTATACCGTAAACAAGCGTCATATATACA[A/G]
AAAGAATAGAGTAAGCCCTCAGTATTAAATGGTAATCGGCCTAATATAGGGAGCATTTGCACAATAGATATTGTATAAAAATATGTTATATGTAAACATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 31.10% | 10.54% | 9.67% | NA |
| All Indica | 2759 | 65.60% | 1.00% | 17.47% | 15.95% | NA |
| All Japonica | 1512 | 9.20% | 90.00% | 0.40% | 0.40% | NA |
| Aus | 269 | 83.30% | 15.20% | 0.00% | 1.49% | NA |
| Indica I | 595 | 64.90% | 0.30% | 22.69% | 12.10% | NA |
| Indica II | 465 | 69.50% | 1.70% | 16.56% | 12.26% | NA |
| Indica III | 913 | 61.60% | 0.40% | 14.79% | 23.22% | NA |
| Indica Intermediate | 786 | 68.60% | 1.70% | 17.18% | 12.60% | NA |
| Temperate Japonica | 767 | 2.60% | 96.60% | 0.13% | 0.65% | NA |
| Tropical Japonica | 504 | 20.20% | 79.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 91.70% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 10.40% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 48.90% | 35.60% | 8.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234417843 | T -> DEL | N | N | silent_mutation | Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0234417843 | T -> C | LOC_Os02g56250.1 | downstream_gene_variant ; 4436.0bp to feature; MODIFIER | silent_mutation | Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0234417843 | T -> C | LOC_Os02g56260.1 | downstream_gene_variant ; 3937.0bp to feature; MODIFIER | silent_mutation | Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0234417843 | T -> C | LOC_Os02g56250-LOC_Os02g56260 | intergenic_region ; MODIFIER | silent_mutation | Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234417843 | NA | 5.48E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | NA | 2.74E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | NA | 1.30E-06 | mr1979 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | NA | 1.05E-19 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | 2.70E-06 | NA | mr1042_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | 6.08E-06 | NA | mr1502_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | NA | 1.28E-07 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234417843 | NA | 7.86E-23 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |