\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234417843:

Variant ID: vg0234417843 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34417843
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTTTACATATAACATATTTTTATACAATATCTATTGTGCAAATGCTCCCTATATTAGGCCGATTACCATTTAATACTGAGGGCTTACTCTATTCTTT[T/C]
TGTATATATGACGCTTGTTTACGGTATACATAATACCCGATTCTTAATCCAAATATGCTCATTACATCCTGACAATACTAGAAGATTTATACAATTTTCT

Reverse complement sequence

AGAAAATTGTATAAATCTTCTAGTATTGTCAGGATGTAATGAGCATATTTGGATTAAGAATCGGGTATTATGTATACCGTAAACAAGCGTCATATATACA[A/G]
AAAGAATAGAGTAAGCCCTCAGTATTAAATGGTAATCGGCCTAATATAGGGAGCATTTGCACAATAGATATTGTATAAAAATATGTTATATGTAAACATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 31.10% 10.54% 9.67% NA
All Indica  2759 65.60% 1.00% 17.47% 15.95% NA
All Japonica  1512 9.20% 90.00% 0.40% 0.40% NA
Aus  269 83.30% 15.20% 0.00% 1.49% NA
Indica I  595 64.90% 0.30% 22.69% 12.10% NA
Indica II  465 69.50% 1.70% 16.56% 12.26% NA
Indica III  913 61.60% 0.40% 14.79% 23.22% NA
Indica Intermediate  786 68.60% 1.70% 17.18% 12.60% NA
Temperate Japonica  767 2.60% 96.60% 0.13% 0.65% NA
Tropical Japonica  504 20.20% 79.20% 0.60% 0.00% NA
Japonica Intermediate  241 7.10% 91.70% 0.83% 0.41% NA
VI/Aromatic  96 86.50% 10.40% 2.08% 1.04% NA
Intermediate  90 48.90% 35.60% 8.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234417843 T -> DEL N N silent_mutation Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0234417843 T -> C LOC_Os02g56250.1 downstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0234417843 T -> C LOC_Os02g56260.1 downstream_gene_variant ; 3937.0bp to feature; MODIFIER silent_mutation Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0234417843 T -> C LOC_Os02g56250-LOC_Os02g56260 intergenic_region ; MODIFIER silent_mutation Average:38.271; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234417843 NA 5.48E-23 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 NA 2.74E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 NA 1.30E-06 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 NA 1.05E-19 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 2.70E-06 NA mr1042_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 6.08E-06 NA mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 NA 1.28E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234417843 NA 7.86E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251