\
| Variant ID: vg0234416765 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34416765 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCACTCTCGAGCAATCAGAGTCGAGTACAGAGTACTATGTTGATCTCCCCTGCAAACTTGTCGTGCGCTTGCATCCTCCCATCTATCATCAAGTCGAACA[C/G]
GACAACAACTAATGCATATTGTGTGTTATGGATAAGGCATGCTTAATGATCTTGGATTGGTCTCGGTGAGGCCCACCATATAACTAGTCTTATACCAAAT
ATTTGGTATAAGACTAGTTATATGGTGGGCCTCACCGAGACCAATCCAAGATCATTAAGCATGCCTTATCCATAACACACAATATGCATTAGTTGTTGTC[G/C]
TGTTCGACTTGATGATAGATGGGAGGATGCAAGCGCACGACAAGTTTGCAGGGGAGATCAACATAGTACTCTGTACTCGACTCTGATTGCTCGAGAGTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 5.30% | 1.69% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.00% | 15.90% | 5.09% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 65.60% | 26.20% | 8.21% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 2.80% | 1.39% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 10.80% | 2.90% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234416765 | C -> G | LOC_Os02g56250.1 | downstream_gene_variant ; 3358.0bp to feature; MODIFIER | silent_mutation | Average:72.715; most accessible tissue: Callus, score: 90.572 | N | N | N | N |
| vg0234416765 | C -> G | LOC_Os02g56250-LOC_Os02g56260 | intergenic_region ; MODIFIER | silent_mutation | Average:72.715; most accessible tissue: Callus, score: 90.572 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234416765 | NA | 7.06E-09 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.59E-07 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 5.81E-07 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 7.32E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.19E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.55E-07 | mr1045_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.70E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 1.10E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 2.06E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 1.99E-06 | NA | mr1480_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 8.87E-06 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 4.93E-06 | 3.41E-08 | mr1550_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 3.76E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.56E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 9.75E-07 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | NA | 1.61E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 8.50E-08 | NA | mr1968_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234416765 | 7.10E-06 | 6.14E-06 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |