\
| Variant ID: vg0234359485 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34359485 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCGAGGCAAATTTTTTAAACCTAATTAATCCATAATTAGAGAATGTTTACTGTAGCATCACATAGGCTAATCATGGATTAATTAGGCTCAATAGATTC[G/A]
TCTCGCGAATTAGTCCAAGATTATGGATTGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAGTGTCCAAACATCCGATGTGATAGCGACTTAAAA
TTTTAAGTCGCTATCACATCGGATGTTTGGACACTAATTATAAATATTAAACGTAGACTATTAATAAAACCAATCCATAATCTTGGACTAATTCGCGAGA[C/T]
GAATCTATTGAGCCTAATTAATCCATGATTAGCCTATGTGATGCTACAGTAAACATTCTCTAATTATGGATTAATTAGGTTTAAAAAATTTGCCTCGCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 3.20% | 2.69% | 0.00% | NA |
| All Indica | 2759 | 95.90% | 2.40% | 1.70% | 0.00% | NA |
| All Japonica | 1512 | 98.70% | 0.50% | 0.73% | 0.00% | NA |
| Aus | 269 | 67.70% | 21.60% | 10.78% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 95.70% | 3.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 93.10% | 3.30% | 3.61% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.40% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 0.80% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 1.70% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 41.70% | 17.70% | 40.62% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234359485 | G -> A | LOC_Os02g56140.1 | upstream_gene_variant ; 2698.0bp to feature; MODIFIER | silent_mutation | Average:27.191; most accessible tissue: Callus, score: 71.334 | N | N | N | N |
| vg0234359485 | G -> A | LOC_Os02g56160.1 | upstream_gene_variant ; 1719.0bp to feature; MODIFIER | silent_mutation | Average:27.191; most accessible tissue: Callus, score: 71.334 | N | N | N | N |
| vg0234359485 | G -> A | LOC_Os02g56170.1 | downstream_gene_variant ; 2816.0bp to feature; MODIFIER | silent_mutation | Average:27.191; most accessible tissue: Callus, score: 71.334 | N | N | N | N |
| vg0234359485 | G -> A | LOC_Os02g56150.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.191; most accessible tissue: Callus, score: 71.334 | N | N | N | N |
| vg0234359485 | G -> A | LOC_Os02g56150.2 | intron_variant ; MODIFIER | silent_mutation | Average:27.191; most accessible tissue: Callus, score: 71.334 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234359485 | 4.02E-06 | NA | mr1281_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234359485 | NA | 5.52E-09 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234359485 | NA | 1.11E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234359485 | 7.26E-06 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234359485 | 4.58E-08 | NA | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |