\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234358656:

Variant ID: vg0234358656 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34358656
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, C: 0.10, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGCAATGGAAGCCAGTCAGGCCGGCCGGCCGGCACGCGCCGCGCATGCGCGGCGCCATGGCAGAGCAGCCGAGCTCGAGGGGAGTGAGCTGGTTTGT[A/C]
GTGCGCGCCCGGACGAACACCTGCGTCTCGTCGGTCAGGCACGCGAGCTGCAGTGGAACCTCGCCAGCTCGCCCATGTCCATGGATTGGAACGCGCCGAC

Reverse complement sequence

GTCGGCGCGTTCCAATCCATGGACATGGGCGAGCTGGCGAGGTTCCACTGCAGCTCGCGTGCCTGACCGACGAGACGCAGGTGTTCGTCCGGGCGCGCAC[T/G]
ACAAACCAGCTCACTCCCCTCGAGCTCGGCTGCTCTGCCATGGCGCCGCGCATGCGCGGCGCGTGCCGGCCGGCCGGCCTGACTGGCTTCCATTGCTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.20% 44.60% 0.17% 0.00% NA
All Indica  2759 86.00% 13.80% 0.22% 0.00% NA
All Japonica  1512 3.10% 96.90% 0.00% 0.00% NA
Aus  269 35.30% 64.30% 0.37% 0.00% NA
Indica I  595 77.30% 22.50% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 87.60% 12.40% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 15.50% 0.64% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.40% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234358656 A -> C LOC_Os02g56140.1 upstream_gene_variant ; 1869.0bp to feature; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0234358656 A -> C LOC_Os02g56160.1 upstream_gene_variant ; 2548.0bp to feature; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0234358656 A -> C LOC_Os02g56130.1 downstream_gene_variant ; 5000.0bp to feature; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0234358656 A -> C LOC_Os02g56170.1 downstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0234358656 A -> C LOC_Os02g56150.1 intron_variant ; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N
vg0234358656 A -> C LOC_Os02g56150.2 intron_variant ; MODIFIER silent_mutation Average:78.007; most accessible tissue: Minghui63 panicle, score: 91.227 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234358656 A C -0.01 -0.02 -0.01 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234358656 NA 1.12E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 9.63E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.78E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 4.10E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.16E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 9.89E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 6.29E-08 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 7.12E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 4.08E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 5.05E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 9.14E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.56E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 7.58E-10 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.31E-11 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 2.86E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 2.51E-14 mr1714_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 8.74E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 9.82E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 2.98E-09 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 2.15E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.83E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234358656 NA 1.51E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251