\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234350385:

Variant ID: vg0234350385 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34350385
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.25, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCAGATTCATATTAAAAAATACTTTATTTTGAGATTGGGGGACTAGTAGGATGATCAAAGAAAAGAGAGCGTGGTGCATTGCTAAGAAACACCAAAAT[G/A]
CTCAATACTTATACACGGCGTGGAAACAAGAAAGCCTCGGTAGGCATGGGTTGTGGAGTGGATCGTGGGCCAGATTGATCGTGGATCGCTCGCTCTCTTC

Reverse complement sequence

GAAGAGAGCGAGCGATCCACGATCAATCTGGCCCACGATCCACTCCACAACCCATGCCTACCGAGGCTTTCTTGTTTCCACGCCGTGTATAAGTATTGAG[C/T]
ATTTTGGTGTTTCTTAGCAATGCACCACGCTCTCTTTTCTTTGATCATCCTACTAGTCCCCCAATCTCAAAATAAAGTATTTTTTAATATGAATCTGGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.70% 0.06% 0.00% NA
All Indica  2759 80.00% 19.90% 0.07% 0.00% NA
All Japonica  1512 9.40% 90.60% 0.00% 0.00% NA
Aus  269 57.20% 42.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 56.80% 43.00% 0.22% 0.00% NA
Indica III  913 78.80% 21.20% 0.00% 0.00% NA
Indica Intermediate  786 80.30% 19.60% 0.13% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 20.40% 79.60% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234350385 G -> A LOC_Os02g56130.1 upstream_gene_variant ; 1022.0bp to feature; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N
vg0234350385 G -> A LOC_Os02g56120.1 downstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N
vg0234350385 G -> A LOC_Os02g56140.1 downstream_gene_variant ; 3345.0bp to feature; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N
vg0234350385 G -> A LOC_Os02g56120.2 downstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N
vg0234350385 G -> A LOC_Os02g56120.3 downstream_gene_variant ; 529.0bp to feature; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N
vg0234350385 G -> A LOC_Os02g56120-LOC_Os02g56130 intergenic_region ; MODIFIER silent_mutation Average:97.677; most accessible tissue: Minghui63 root, score: 98.764 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234350385 G A 0.0 -0.03 -0.02 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234350385 NA 1.14E-13 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 2.43E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 6.95E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 2.39E-10 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 2.79E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 5.49E-07 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 7.67E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.85E-08 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 8.47E-08 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 7.51E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 2.09E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.10E-09 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 9.17E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 4.70E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 7.95E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 2.07E-07 7.96E-16 mr1478_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.93E-07 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.00E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 5.40E-06 mr1712_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 2.76E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.23E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.46E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 1.20E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234350385 NA 4.44E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251