\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234328298:

Variant ID: vg0234328298 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34328298
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 134. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAATACATAAAGAAAGGAAGGGAAGCCGAGTGATCACATCGCCGCAACCACCAACCTCTCGAGGCCGTTCGAATCCCTCTCTCTCTTCTCCAATTCCC[C/A]
AATCACCGATCACCGCGCCGCCGATCGGGTTCGTGTGTGTGCCCTCGACGTGTTCGACGGAAAGCCCGCGAGAAGCGGAGGCCGGCTGCGGCGACGGCGA

Reverse complement sequence

TCGCCGTCGCCGCAGCCGGCCTCCGCTTCTCGCGGGCTTTCCGTCGAACACGTCGAGGGCACACACACGAACCCGATCGGCGGCGCGGTGATCGGTGATT[G/T]
GGGAATTGGAGAAGAGAGAGAGGGATTCGAACGGCCTCGAGAGGTTGGTGGTTGCGGCGATGTGATCACTCGGCTTCCCTTCCTTTCTTTATGTATTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 7.60% 0.00% 0.00% NA
All Indica  2759 87.20% 12.80% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 70.10% 29.90% 0.00% 0.00% NA
Indica III  913 85.30% 14.70% 0.00% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234328298 C -> A LOC_Os02g56100.1 5_prime_UTR_variant ; 103.0bp to feature; MODIFIER silent_mutation Average:79.365; most accessible tissue: Callus, score: 97.436 N N N N
vg0234328298 C -> A LOC_Os02g56080.1 upstream_gene_variant ; 4212.0bp to feature; MODIFIER silent_mutation Average:79.365; most accessible tissue: Callus, score: 97.436 N N N N
vg0234328298 C -> A LOC_Os02g56090.1 downstream_gene_variant ; 944.0bp to feature; MODIFIER silent_mutation Average:79.365; most accessible tissue: Callus, score: 97.436 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234328298 NA 3.76E-07 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 5.08E-07 mr1165 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 8.39E-06 mr1415 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 7.27E-07 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 8.39E-06 mr1567 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 9.76E-06 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 9.60E-11 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 5.69E-06 mr1842 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 3.70E-08 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 2.49E-06 mr1165_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 3.00E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 1.03E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 9.99E-06 mr1439_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 4.97E-06 NA mr1478_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 2.88E-11 mr1478_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 2.89E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 1.05E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234328298 NA 1.02E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251