Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0234244837:

Variant ID: vg0234244837 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34244837
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

GCTATACTAAATAGCTTTTGCAGAATTTTGCGTGCTACCTGTTATGCTGTGGTTTCTGTTGTTTCTACTGCCCGAACTCATGAGGTATTTGCCATTTGGA[G/A]
GTTCTCTACACTACAGCTATTTCCATTGATCTTGTTTATCAACTACTCAGACACAATTTGTACTTATGCTAACATAGGAGTCATGCATGTGGGTTTATTC

Reverse complement sequence

GAATAAACCCACATGCATGACTCCTATGTTAGCATAAGTACAAATTGTGTCTGAGTAGTTGATAAACAAGATCAATGGAAATAGCTGTAGTGTAGAGAAC[C/T]
TCCAAATGGCAAATACCTCATGAGTTCGGGCAGTAGAAACAACAGAAACCACAGCATAACAGGTAGCACGCAAAATTCTGCAAAAGCTATTTAGTATAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	7.90%	2.79%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.07%	0.00%	NA
All Japonica	1512	67.90%	23.80%	8.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	47.60%	40.20%	12.26%	0.00%	NA
Tropical Japonica	504	96.40%	0.60%	2.98%	0.00%	NA
Japonica Intermediate	241	72.60%	20.30%	7.05%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	11.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234244837	G -> A	LOC_Os02g55940.1	downstream_gene_variant ; 2735.0bp to feature; MODIFIER	silent_mutation	Average:48.387; most accessible tissue: Callus, score: 66.396	N	N	N	N
vg0234244837	G -> A	LOC_Os02g55950.1	intron_variant ; MODIFIER	silent_mutation	Average:48.387; most accessible tissue: Callus, score: 66.396	N	N	N	N
vg0234244837	G -> A	LOC_Os02g55950.2	intron_variant ; MODIFIER	silent_mutation	Average:48.387; most accessible tissue: Callus, score: 66.396	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234244837	NA	1.32E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	NA	7.28E-11	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	NA	5.63E-07	mr1872	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	2.83E-06	NA	mr1882	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	NA	2.38E-06	mr1882	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	NA	2.95E-06	mr1910	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234244837	NA	2.87E-09	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251