Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234219499:

Variant ID: vg0234219499 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 34219499
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GCCATAAATGATTTGGAGTTAGTAGTTGGCTATACTATTAAACTTGCTCTAACTGAAGAGAGAGATTGAAGTGGGCGACTATTTAAGTGCCCGGCGATAG[C/T]
ACGCGTTGCACGATAAAAAAATACATTTTGTGGGCCCCACAACCACCCTCATCGGATCTCATGTCTCATACTTGTGTTCCCACCTATGTTCTGCTTTTCG

Reverse complement sequence

CGAAAAGCAGAACATAGGTGGGAACACAAGTATGAGACATGAGATCCGATGAGGGTGGTTGTGGGGCCCACAAAATGTATTTTTTTATCGTGCAACGCGT[G/A]
CTATCGCCGGGCACTTAAATAGTCGCCCACTTCAATCTCTCTCTTCAGTTAGAGCAAGTTTAATAGTATAGCCAACTACTAACTCCAAATCATTTATGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.60%	42.30%	0.19%	0.00%	NA
All Indica	2759	29.10%	70.60%	0.29%	0.00%	NA
All Japonica	1512	98.50%	1.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	28.40%	71.40%	0.17%	0.00%	NA
Indica II	465	10.80%	89.20%	0.00%	0.00%	NA
Indica III	913	37.20%	62.20%	0.55%	0.00%	NA
Indica Intermediate	786	31.20%	68.60%	0.25%	0.00%	NA
Temperate Japonica	767	97.70%	2.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0234219499	C -> T	LOC_Os02g55890.1	upstream_gene_variant ; 4491.0bp to feature; MODIFIER	silent_mutation	Average:98.58; most accessible tissue: Minghui63 flower, score: 99.763	N	N	N	N
vg0234219499	C -> T	LOC_Os02g55910.1	upstream_gene_variant ; 3618.0bp to feature; MODIFIER	silent_mutation	Average:98.58; most accessible tissue: Minghui63 flower, score: 99.763	N	N	N	N
vg0234219499	C -> T	LOC_Os02g55910.2	upstream_gene_variant ; 4239.0bp to feature; MODIFIER	silent_mutation	Average:98.58; most accessible tissue: Minghui63 flower, score: 99.763	N	N	N	N
vg0234219499	C -> T	LOC_Os02g55900.1	intron_variant ; MODIFIER	silent_mutation	Average:98.58; most accessible tissue: Minghui63 flower, score: 99.763	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0234219499	C	T	-0.04	-0.03	-0.01	0.01	-0.03	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0234219499	2.01E-06	NA	mr1011	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	3.18E-32	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	3.07E-48	mr1063	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	2.27E-09	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	4.83E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	3.98E-28	mr1221	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	4.02E-10	mr1714	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	1.47E-12	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	4.86E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	1.19E-14	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234219499	NA	6.67E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251