\
| Variant ID: vg0234163711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 34163711 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )
TCGCTTGGTATCTACGTACAACACCTGCAATAAGCTCTCAGGAACGATGCTTCAATTTGACTTAGGCCTGGTTTAGTTCCCAATTTTTTCTTCAAACTTC[C/T,G]
AATTTTTCCATCACATTAAAACTTTCCTACACACACAAATTTCTAATTTTTCTGTCACATCGTTACAATTTCAATCAAACTTTTAATTTTGGTGTGAACT
AGTTCACACCAAAATTAAAAGTTTGATTGAAATTGTAACGATGTGACAGAAAAATTAGAAATTTGTGTGTGTAGGAAAGTTTTAATGTGATGGAAAAATT[G/A,C]
GAAGTTTGAAGAAAAAATTGGGAACTAAACCAGGCCTAAGTCAAATTGAAGCATCGTTCCTGAGAGCTTATTGCAGGTGTTGTACGTAGATACCAAGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 5.10% | 3.94% | 1.78% | NA |
| All Indica | 2759 | 91.20% | 0.00% | 5.73% | 3.01% | NA |
| All Japonica | 1512 | 82.80% | 15.40% | 1.72% | 0.07% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 0.00% | 7.06% | 2.02% | NA |
| Indica II | 465 | 98.10% | 0.00% | 1.29% | 0.65% | NA |
| Indica III | 913 | 88.00% | 0.00% | 6.57% | 5.48% | NA |
| Indica Intermediate | 786 | 91.20% | 0.10% | 6.36% | 2.29% | NA |
| Temperate Japonica | 767 | 85.30% | 12.30% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 5.80% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 51.90% | 45.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0234163711 | C -> G | LOC_Os02g55810.1 | upstream_gene_variant ; 3977.0bp to feature; MODIFIER | N | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> G | LOC_Os02g55790.1 | downstream_gene_variant ; 2215.0bp to feature; MODIFIER | N | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> G | LOC_Os02g55800.1 | downstream_gene_variant ; 739.0bp to feature; MODIFIER | N | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> G | LOC_Os02g55790-LOC_Os02g55800 | intergenic_region ; MODIFIER | N | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> T | LOC_Os02g55810.1 | upstream_gene_variant ; 3977.0bp to feature; MODIFIER | silent_mutation | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> T | LOC_Os02g55790.1 | downstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> T | LOC_Os02g55800.1 | downstream_gene_variant ; 739.0bp to feature; MODIFIER | silent_mutation | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> T | LOC_Os02g55790-LOC_Os02g55800 | intergenic_region ; MODIFIER | silent_mutation | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| vg0234163711 | C -> DEL | N | N | silent_mutation | Average:53.79; most accessible tissue: Callus, score: 82.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0234163711 | 3.06E-07 | NA | mr1922 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | 8.99E-06 | 1.04E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | 5.38E-06 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 6.33E-07 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 5.36E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 5.63E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | 8.52E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 1.08E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 2.17E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 2.00E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0234163711 | NA | 1.12E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |