\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234163711:

Variant ID: vg0234163711 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34163711
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCTTGGTATCTACGTACAACACCTGCAATAAGCTCTCAGGAACGATGCTTCAATTTGACTTAGGCCTGGTTTAGTTCCCAATTTTTTCTTCAAACTTC[C/T,G]
AATTTTTCCATCACATTAAAACTTTCCTACACACACAAATTTCTAATTTTTCTGTCACATCGTTACAATTTCAATCAAACTTTTAATTTTGGTGTGAACT

Reverse complement sequence

AGTTCACACCAAAATTAAAAGTTTGATTGAAATTGTAACGATGTGACAGAAAAATTAGAAATTTGTGTGTGTAGGAAAGTTTTAATGTGATGGAAAAATT[G/A,C]
GAAGTTTGAAGAAAAAATTGGGAACTAAACCAGGCCTAAGTCAAATTGAAGCATCGTTCCTGAGAGCTTATTGCAGGTGTTGTACGTAGATACCAAGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 5.10% 3.94% 1.78% NA
All Indica  2759 91.20% 0.00% 5.73% 3.01% NA
All Japonica  1512 82.80% 15.40% 1.72% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 90.90% 0.00% 7.06% 2.02% NA
Indica II  465 98.10% 0.00% 1.29% 0.65% NA
Indica III  913 88.00% 0.00% 6.57% 5.48% NA
Indica Intermediate  786 91.20% 0.10% 6.36% 2.29% NA
Temperate Japonica  767 85.30% 12.30% 2.48% 0.00% NA
Tropical Japonica  504 93.80% 5.80% 0.20% 0.20% NA
Japonica Intermediate  241 51.90% 45.60% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234163711 C -> G LOC_Os02g55810.1 upstream_gene_variant ; 3977.0bp to feature; MODIFIER N Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> G LOC_Os02g55790.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER N Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> G LOC_Os02g55800.1 downstream_gene_variant ; 739.0bp to feature; MODIFIER N Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> G LOC_Os02g55790-LOC_Os02g55800 intergenic_region ; MODIFIER N Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> T LOC_Os02g55810.1 upstream_gene_variant ; 3977.0bp to feature; MODIFIER silent_mutation Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> T LOC_Os02g55790.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> T LOC_Os02g55800.1 downstream_gene_variant ; 739.0bp to feature; MODIFIER silent_mutation Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> T LOC_Os02g55790-LOC_Os02g55800 intergenic_region ; MODIFIER silent_mutation Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N
vg0234163711 C -> DEL N N silent_mutation Average:53.79; most accessible tissue: Callus, score: 82.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234163711 3.06E-07 NA mr1922 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 8.99E-06 1.04E-06 mr1922 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 5.38E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 6.33E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 5.36E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 5.63E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 8.52E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 1.08E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 2.17E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 2.00E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234163711 NA 1.12E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251