\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0234022553:

Variant ID: vg0234022553 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 34022553
Reference Allele: AAlternative Allele: T,C
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTACTCACGCGAATACGTACTTCCTTCCTCTGTAAAAAAAAGAAAGACAAACCTTGAATTTCTACGTTCAACGTTTGATTTTTCATCTTATATAAAA[A/T,C]
TTTTTTACAATTAATATTTTTATTATTGTTAGATGATAAAACATGATTAATATTTTATACGTGACTTGTCCTTTTAAATTTTTTATATTTTTTTTTAAAT

Reverse complement sequence

ATTTAAAAAAAAATATAAAAAATTTAAAAGGACAAGTCACGTATAAAATATTAATCATGTTTTATCATCTAACAATAATAAAAATATTAATTGTAAAAAA[T/A,G]
TTTTATATAAGATGAAAAATCAAACGTTGAACGTAGAAATTCAAGGTTTGTCTTTCTTTTTTTTACAGAGGAAGGAAGTACGTATTCGCGTGAGTAGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.00% 0.51% 0.00% C: 0.11%
All Indica  2759 96.20% 3.40% 0.33% 0.00% C: 0.04%
All Japonica  1512 5.40% 93.70% 0.93% 0.00% NA
Aus  269 26.40% 73.20% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 95.10% 3.00% 1.94% 0.00% NA
Indica III  913 95.20% 4.70% 0.00% 0.00% C: 0.11%
Indica Intermediate  786 95.30% 4.70% 0.00% 0.00% NA
Temperate Japonica  767 2.60% 96.70% 0.65% 0.00% NA
Tropical Japonica  504 8.10% 90.70% 1.19% 0.00% NA
Japonica Intermediate  241 8.30% 90.50% 1.24% 0.00% NA
VI/Aromatic  96 53.10% 42.70% 0.00% 0.00% C: 4.17%
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0234022553 A -> T LOC_Os02g55560.1 upstream_gene_variant ; 3720.0bp to feature; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N
vg0234022553 A -> T LOC_Os02g55560.2 upstream_gene_variant ; 3720.0bp to feature; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N
vg0234022553 A -> T LOC_Os02g55550-LOC_Os02g55560 intergenic_region ; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N
vg0234022553 A -> C LOC_Os02g55560.1 upstream_gene_variant ; 3720.0bp to feature; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N
vg0234022553 A -> C LOC_Os02g55560.2 upstream_gene_variant ; 3720.0bp to feature; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N
vg0234022553 A -> C LOC_Os02g55550-LOC_Os02g55560 intergenic_region ; MODIFIER silent_mutation Average:94.763; most accessible tissue: Callus, score: 99.379 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0234022553 A C -0.03 -0.04 -0.05 -0.03 -0.04 -0.04
vg0234022553 A T -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0234022553 NA 6.18E-10 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 NA 1.82E-21 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 NA 1.46E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 7.94E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 1.77E-07 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 9.88E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 NA 2.15E-38 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 NA 1.59E-68 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0234022553 NA 1.56E-95 mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251