\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0233935333:

Variant ID: vg0233935333 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33935333
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGCACGTAGATGTAATACTATTGAAAGTACATGTATGAATTTTTCTAAAATTTTTTGTGATAATTTTTAGTTGGTGTACACGGTGCGTACACGCGAGG[G/C]
CCTGTGTGCATAGGATACGCTCCCTATAATAATACAGTACTCCCTATGACTCCCTTAACTTTTTTATCAACGTTTGATCATTTGTCTTATTTAAAATATT

Reverse complement sequence

AATATTTTAAATAAGACAAATGATCAAACGTTGATAAAAAAGTTAAGGGAGTCATAGGGAGTACTGTATTATTATAGGGAGCGTATCCTATGCACACAGG[C/G]
CCTCGCGTGTACGCACCGTGTACACCAACTAAAAATTATCACAAAAAATTTTAGAAAAATTCATACATGTACTTTCAATAGTATTACATCTACGTGCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.20% 0.06% 0.00% NA
All Indica  2759 83.80% 16.10% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 88.90% 11.10% 0.00% 0.00% NA
Indica II  465 94.60% 5.40% 0.00% 0.00% NA
Indica III  913 75.90% 24.00% 0.11% 0.00% NA
Indica Intermediate  786 82.80% 17.00% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233935333 G -> C LOC_Os02g55410.1 downstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0233935333 G -> C LOC_Os02g55410.2 downstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0233935333 G -> C LOC_Os02g55400.1 intron_variant ; MODIFIER silent_mutation Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233935333 NA 3.18E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 9.39E-06 NA mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 8.41E-06 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 1.84E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 4.94E-07 4.94E-07 mr1996 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 4.17E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 4.45E-06 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 1.99E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 3.58E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233935333 NA 3.95E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251