\
| Variant ID: vg0233935333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33935333 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTGCACGTAGATGTAATACTATTGAAAGTACATGTATGAATTTTTCTAAAATTTTTTGTGATAATTTTTAGTTGGTGTACACGGTGCGTACACGCGAGG[G/C]
CCTGTGTGCATAGGATACGCTCCCTATAATAATACAGTACTCCCTATGACTCCCTTAACTTTTTTATCAACGTTTGATCATTTGTCTTATTTAAAATATT
AATATTTTAAATAAGACAAATGATCAAACGTTGATAAAAAAGTTAAGGGAGTCATAGGGAGTACTGTATTATTATAGGGAGCGTATCCTATGCACACAGG[C/G]
CCTCGCGTGTACGCACCGTGTACACCAACTAAAAATTATCACAAAAAATTTTAGAAAAATTCATACATGTACTTTCAATAGTATTACATCTACGTGCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 11.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 83.80% | 16.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.20% | 23.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.90% | 24.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 17.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233935333 | G -> C | LOC_Os02g55410.1 | downstream_gene_variant ; 855.0bp to feature; MODIFIER | silent_mutation | Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0233935333 | G -> C | LOC_Os02g55410.2 | downstream_gene_variant ; 855.0bp to feature; MODIFIER | silent_mutation | Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0233935333 | G -> C | LOC_Os02g55400.1 | intron_variant ; MODIFIER | silent_mutation | Average:34.688; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233935333 | NA | 3.18E-07 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | 9.39E-06 | NA | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 8.41E-06 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 1.84E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | 4.94E-07 | 4.94E-07 | mr1996 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 4.17E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 4.45E-06 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 1.99E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 3.58E-07 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233935333 | NA | 3.95E-06 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |