\
| Variant ID: vg0233906724 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33906724 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGATTATTTCTGATATTAGAAGAGCCGGTGCTTGATTTTAAATCTTTGTGCGAAATTGGCAAAACTGGAGACTAGGGGCGGTCTGACCGGCGTTGCACGG[C/T]
CGGTCTGATCGGTGACCAGGGGCAGTCTGACCGGCCGTATGCTGCCGGTCTGACCGGCGACCCCGAGCGGTCTGACCGGCCCTGCGTGGCCGGTCTGACC
GGTCAGACCGGCCACGCAGGGCCGGTCAGACCGCTCGGGGTCGCCGGTCAGACCGGCAGCATACGGCCGGTCAGACTGCCCCTGGTCACCGATCAGACCG[G/A]
CCGTGCAACGCCGGTCAGACCGCCCCTAGTCTCCAGTTTTGCCAATTTCGCACAAAGATTTAAAATCAAGCACCGGCTCTTCTAATATCAGAAATAATCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 1.90% | 10.22% | 0.00% | NA |
| All Indica | 2759 | 79.60% | 3.30% | 17.07% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 86.10% | 1.70% | 12.27% | 0.00% | NA |
| Indica II | 465 | 73.50% | 7.50% | 18.92% | 0.00% | NA |
| Indica III | 913 | 72.80% | 4.10% | 23.11% | 0.00% | NA |
| Indica Intermediate | 786 | 86.30% | 1.10% | 12.60% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233906724 | C -> T | LOC_Os02g55360.1 | upstream_gene_variant ; 2291.0bp to feature; MODIFIER | silent_mutation | Average:27.296; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| vg0233906724 | C -> T | LOC_Os02g55350.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.296; most accessible tissue: Zhenshan97 flag leaf, score: 48.165 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233906724 | NA | 4.05E-10 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233906724 | 5.38E-10 | NA | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233906724 | 8.72E-08 | 4.89E-12 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233906724 | 7.76E-10 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233906724 | 2.20E-08 | 1.23E-11 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |