\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233865573:

Variant ID: vg0233865573 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 33865573
Reference Allele: CAlternative Allele: CT,T,CTT,CTTT
Primary Allele: CSecondary Allele: CT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


CAATGAAATGGTTATTCTTGTGTTTCTCCTATATTTTATAATCCTCTGTTTTGTACATGCAATTGTTATTAGAATTATACGTTTTTTTTCTATTTCTTCC[C/CT,T,CTT,CTTT]
TTTTTTTTCATTGGCCCCTACGGAGTACCACCAAACAGTATAATACCATATACATATTTACTGCTTGTATAAAAATACTGTAGTAATTATAGAGAAGCGT

Reverse complement sequence

ACGCTTCTCTATAATTACTACAGTATTTTTATACAAGCAGTAAATATGTATATGGTATTATACTGTTTGGTGGTACTCCGTAGGGGCCAATGAAAAAAAA[G/AG,A,AAG,AAAG]
GGAAGAAATAGAAAAAAAACGTATAATTCTAATAACAATTGCATGTACAAAACAGAGGATTATAAAATATAGGAGAAACACAAGAATAACCATTTCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 18.80% 2.98% 0.51% T: 7.30%; CTT: 0.34%
All Indica  2759 60.10% 28.80% 4.97% 0.87% T: 4.68%; CTT: 0.58%
All Japonica  1512 99.20% 0.20% 0.07% 0.00% T: 0.53%
Aus  269 4.80% 25.30% 0.74% 0.00% T: 69.14%
Indica I  595 84.40% 2.20% 11.26% 2.18% NA
Indica II  465 52.30% 42.60% 3.23% 0.00% T: 1.94%
Indica III  913 47.20% 40.10% 2.30% 0.66% T: 8.98%; CTT: 0.77%
Indica Intermediate  786 61.50% 27.60% 4.33% 0.64% T: 4.83%; CTT: 1.15%
Temperate Japonica  767 99.20% 0.30% 0.13% 0.00% T: 0.39%
Tropical Japonica  504 99.80% 0.00% 0.00% 0.00% T: 0.20%
Japonica Intermediate  241 97.90% 0.40% 0.00% 0.00% T: 1.66%
VI/Aromatic  96 72.90% 12.50% 0.00% 0.00% T: 14.58%
Intermediate  90 76.70% 13.30% 1.11% 0.00% T: 8.89%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233865573 C -> CTTT LOC_Os02g55320.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER N Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> CTTT LOC_Os02g55320-LOC_Os02g55330 intergenic_region ; MODIFIER N Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> DEL N N silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> CTT LOC_Os02g55320.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> CTT LOC_Os02g55320-LOC_Os02g55330 intergenic_region ; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> CT LOC_Os02g55320.1 upstream_gene_variant ; 732.0bp to feature; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> CT LOC_Os02g55320-LOC_Os02g55330 intergenic_region ; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> T LOC_Os02g55320.1 upstream_gene_variant ; 731.0bp to feature; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N
vg0233865573 C -> T LOC_Os02g55320-LOC_Os02g55330 intergenic_region ; MODIFIER silent_mutation Average:69.507; most accessible tissue: Callus, score: 93.041 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233865573 NA 1.79E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.32E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.21E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 1.13E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.28E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.44E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.74E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 1.08E-21 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 9.52E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 1.37E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.11E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.42E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 8.28E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 7.51E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 4.17E-08 mr1348 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.44E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.55E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 5.43E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 1.02E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.17E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 9.93E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.93E-09 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 5.43E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 4.43E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 3.00E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 1.69E-06 NA mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 2.13E-09 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 8.43E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 8.05E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 1.31E-06 1.10E-10 mr1764 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 1.40E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 6.82E-15 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 4.23E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233865573 NA 8.03E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251