Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233859530:

Variant ID: vg0233859530 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33859530
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTGCTTTAAGAAAGTTTACCTTCTTCTCAATCCCTTTTTTTAAAAAAAAAATTAGTAAATTTCAGAAAACTGCAACTATAGTCATAAAACTGTAGTGTG[C/G]
TGCAACATTAGTGATCTATTTCAGTTTGCTGTAATAATAACGTGGAAAATTATCACAAAATTACAACTTTTACGTGATATGCGTAGAAGTTACAGTTTCG

Reverse complement sequence

CGAAACTGTAACTTCTACGCATATCACGTAAAAGTTGTAATTTTGTGATAATTTTCCACGTTATTATTACAGCAAACTGAAATAGATCACTAATGTTGCA[G/C]
CACACTACAGTTTTATGACTATAGTTGCAGTTTTCTGAAATTTACTAATTTTTTTTTTAAAAAAAGGGATTGAGAAGAAGGTAAACTTTCTTAAAGCAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.40%	6.60%	0.00%	0.00%	NA
All Indica	2759	96.70%	3.30%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	30.10%	69.90%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	93.90%	6.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233859530	C -> G	LOC_Os02g55310.1	upstream_gene_variant ; 125.0bp to feature; MODIFIER	silent_mutation	Average:84.682; most accessible tissue: Zhenshan97 panicle, score: 92.533	N	N	N	N
vg0233859530	C -> G	LOC_Os02g55300.1	downstream_gene_variant ; 2482.0bp to feature; MODIFIER	silent_mutation	Average:84.682; most accessible tissue: Zhenshan97 panicle, score: 92.533	N	N	N	N
vg0233859530	C -> G	LOC_Os02g55320.1	downstream_gene_variant ; 295.0bp to feature; MODIFIER	silent_mutation	Average:84.682; most accessible tissue: Zhenshan97 panicle, score: 92.533	N	N	N	N
vg0233859530	C -> G	LOC_Os02g55310-LOC_Os02g55320	intergenic_region ; MODIFIER	silent_mutation	Average:84.682; most accessible tissue: Zhenshan97 panicle, score: 92.533	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233859530	NA	2.32E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	5.96E-06	mr1007	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	3.23E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.12E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.52E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	3.67E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	1.80E-21	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.45E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.20E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	1.04E-06	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	5.40E-06	NA	mr1346	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	4.67E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	9.17E-09	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	7.26E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	5.22E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	3.64E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	1.02E-13	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.08E-08	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	9.17E-09	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	2.75E-06	NA	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	3.80E-07	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	2.85E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233859530	NA	3.67E-13	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251