\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233793468:

Variant ID: vg0233793468 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33793468
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 372. )

Flanking Sequence (100 bp) in Reference Genome:


CACCAGTTCATCTGCCTAAGATCATAAATGGTTAGTTCAATTTCATGAAGGTTAGACCAGAAATTGTACAAACTTCAAATATAATCAACATAGAACCCTA[T/C]
TAATGATACAGCGAAGTAGTTTTAGCTATACGAATGCTGCAACGTACGTCACAACGCGTCCACTTCAAAACAACCACAATGCAAGACCAGGGAAAAGACA

Reverse complement sequence

TGTCTTTTCCCTGGTCTTGCATTGTGGTTGTTTTGAAGTGGACGCGTTGTGACGTACGTTGCAGCATTCGTATAGCTAAAACTACTTCGCTGTATCATTA[A/G]
TAGGGTTCTATGTTGATTATATTTGAAGTTTGTACAATTTCTGGTCTAACCTTCATGAAATTGAACTAACCATTTATGATCTTAGGCAGATGAACTGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.50% 0.42% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 91.30% 7.50% 1.26% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 97.80% 1.30% 0.91% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 64.30% 30.70% 4.98% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233793468 T -> C LOC_Os02g55150.1 upstream_gene_variant ; 2482.0bp to feature; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N
vg0233793468 T -> C LOC_Os02g55180.1 upstream_gene_variant ; 3898.0bp to feature; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N
vg0233793468 T -> C LOC_Os02g55150.2 upstream_gene_variant ; 2528.0bp to feature; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N
vg0233793468 T -> C LOC_Os02g55180.2 upstream_gene_variant ; 3898.0bp to feature; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N
vg0233793468 T -> C LOC_Os02g55160.1 downstream_gene_variant ; 839.0bp to feature; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N
vg0233793468 T -> C LOC_Os02g55170.1 intron_variant ; MODIFIER silent_mutation Average:51.696; most accessible tissue: Callus, score: 78.16 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233793468 NA 7.76E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233793468 NA 5.40E-06 mr1332_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233793468 NA 2.61E-06 mr1417_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233793468 4.24E-07 NA mr1750_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251