\
| Variant ID: vg0233741277 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33741277 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 304. )
GTTACAATGTTACAAGCAGAGCTGAATTCAACCACAACATTAGGGAGGTTTACACCTAATATACAAGAGATACATGCACAATTCTATATCAGGCAAAAAA[A/G]
AACTGGGGAAAAAGAGGAGCACATCAACATATAGCTTCCACATAGCACGTGCACACTTACATTTCAACCTAAACAGGACCGAACCTTCAAGGGAAAAAGA
TCTTTTTCCCTTGAAGGTTCGGTCCTGTTTAGGTTGAAATGTAAGTGTGCACGTGCTATGTGGAAGCTATATGTTGATGTGCTCCTCTTTTTCCCCAGTT[T/C]
TTTTTTGCCTGATATAGAATTGTGCATGTATCTCTTGTATATTAGGTGTAAACCTCCCTAATGTTGTGGTTGAATTCAGCTCTGCTTGTAACATTGTAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.90% | 23.70% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 27.80% | 71.20% | 1.06% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 9.50% | 89.30% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 39.30% | 59.90% | 0.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 36.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 25.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233741277 | A -> G | LOC_Os02g55080.1 | upstream_gene_variant ; 3948.0bp to feature; MODIFIER | silent_mutation | Average:56.88; most accessible tissue: Callus, score: 83.906 | N | N | N | N |
| vg0233741277 | A -> G | LOC_Os02g55100.1 | upstream_gene_variant ; 3715.0bp to feature; MODIFIER | silent_mutation | Average:56.88; most accessible tissue: Callus, score: 83.906 | N | N | N | N |
| vg0233741277 | A -> G | LOC_Os02g55090.1 | intron_variant ; MODIFIER | silent_mutation | Average:56.88; most accessible tissue: Callus, score: 83.906 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233741277 | NA | 1.25E-14 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 3.69E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 8.08E-10 | mr1690 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 4.29E-06 | mr1782 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 9.38E-06 | mr1890 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | 9.22E-07 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 3.26E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233741277 | NA | 3.15E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |