Variant ID: vg0233733433 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 33733433 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 281. )
GGCATCATCCAATGAATTGTTGGAGAAGATTACCCAGCAGCTTTTGAGCGACTCACATGTTGCACCAGCCTCAGATGAGAAACGGGTGATGGCAAGGGTT[G/T]
GTTCTCTTCTTTCTCTGCTTCAGAAAGACGCAGTGCCAGCCAATTTACCCAAGTTTGAGCCCAATGACAGCGGCAAGATTGGTGTAGTTGAAGTGGGAAT
ATTCCCACTTCAACTACACCAATCTTGCCGCTGTCATTGGGCTCAAACTTGGGTAAATTGGCTGGCACTGCGTCTTTCTGAAGCAGAGAAAGAAGAGAAC[C/A]
AACCCTTGCCATCACCCGTTTCTCATCTGAGGCTGGTGCAACATGTGAGTCGCTCAAAAGCTGCTGGGTAATCTTCTCCAACAATTCATTGGATGATGCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
All Indica | 2759 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0233733433 | G -> T | LOC_Os02g55070.1 | missense_variant ; p.Gly451Cys; MODERATE | nonsynonymous_codon ; G451C | Average:69.448; most accessible tissue: Callus, score: 82.572 | unknown | unknown | DELETERIOUS | 0.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0233733433 | NA | 3.36E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 4.16E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 6.66E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 3.10E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | 4.03E-06 | 7.94E-13 | mr1471 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 2.16E-06 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 3.86E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | 7.60E-06 | 6.09E-12 | mr1722 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 4.83E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233733433 | NA | 7.20E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/