\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233688245:

Variant ID: vg0233688245 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33688245
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAATAGAAATACAATTATAAATAATAAAAATTCAGAATTCAAAAAAAATAAATATTAAAAGACGAGTCTAGAGTCCATATAGGAATATATATAATTTA[T/C]
AAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACATGTATATAAAATACAATATGAATATTACACATTAGTAGTTTCGTAAAGTTATAGCAAA

Reverse complement sequence

TTTGCTATAACTTTACGAAACTACTAATGTGTAATATTCATATTGTATTTTATATACATGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTT[A/G]
TAAATTATATATATTCCTATATGGACTCTAGACTCGTCTTTTAATATTTATTTTTTTTGAATTCTGAATTTTTATTATTTATAATTGTATTTCTATTTGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 35.50% 8.87% 0.80% NA
All Indica  2759 82.30% 1.80% 14.53% 1.30% NA
All Japonica  1512 1.10% 98.10% 0.73% 0.07% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 87.90% 0.30% 8.91% 2.86% NA
Indica II  465 53.50% 2.20% 42.15% 2.15% NA
Indica III  913 95.90% 1.20% 2.85% 0.00% NA
Indica Intermediate  786 79.30% 3.60% 16.03% 1.15% NA
Temperate Japonica  767 0.70% 98.20% 1.04% 0.13% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 95.40% 1.24% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 38.90% 52.20% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233688245 T -> DEL N N silent_mutation Average:80.414; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N
vg0233688245 T -> C LOC_Os02g54980.1 upstream_gene_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:80.414; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N
vg0233688245 T -> C LOC_Os02g54990.2 downstream_gene_variant ; 2494.0bp to feature; MODIFIER silent_mutation Average:80.414; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N
vg0233688245 T -> C LOC_Os02g54970-LOC_Os02g54980 intergenic_region ; MODIFIER silent_mutation Average:80.414; most accessible tissue: Zhenshan97 flag leaf, score: 92.686 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0233688245 T C -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233688245 NA 1.11E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 7.35E-76 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 2.46E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 5.84E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 2.14E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 1.36E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 1.02E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 1.95E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 4.06E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 3.90E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 5.71E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 1.33E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 2.49E-27 mr1386_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 5.08E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 3.85E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 8.00E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 9.39E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233688245 NA 2.91E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251