\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233663282:

Variant ID: vg0233663282 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33663282
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TATGTAAATGTAAACCTTGATAGAACATCAAGACACTTGTCCCCTTCCTTTTCCTTCTGCCCTTGTTAATTGAATGTTGTCCATCTTATCAATAAATGAG[G/A]
TATCGATCCAAATTGCGTATCGAGAAACAAAGTTATTTTAAAATTTAGGCATTTATATAAAAAGATGGAACCAGTGATACCTACAATTATGATGGTCGTT

Reverse complement sequence

AACGACCATCATAATTGTAGGTATCACTGGTTCCATCTTTTTATATAAATGCCTAAATTTTAAAATAACTTTGTTTCTCGATACGCAATTTGGATCGATA[C/T]
CTCATTTATTGATAAGATGGACAACATTCAATTAACAAGGGCAGAAGGAAAAGGAAGGGGACAAGTGTCTTGATGTTCTATCAAGGTTTACATTTACATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 2.80% 0.42% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 90.40% 8.40% 1.19% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 83.80% 13.80% 2.35% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233663282 G -> A LOC_Os02g54950.1 upstream_gene_variant ; 1297.0bp to feature; MODIFIER silent_mutation Average:23.44; most accessible tissue: Callus, score: 61.176 N N N N
vg0233663282 G -> A LOC_Os02g54960.1 upstream_gene_variant ; 273.0bp to feature; MODIFIER silent_mutation Average:23.44; most accessible tissue: Callus, score: 61.176 N N N N
vg0233663282 G -> A LOC_Os02g54950-LOC_Os02g54960 intergenic_region ; MODIFIER silent_mutation Average:23.44; most accessible tissue: Callus, score: 61.176 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233663282 6.77E-06 6.76E-06 mr1036_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 2.40E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 4.19E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 2.67E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 1.02E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 2.63E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 8.22E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 5.53E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 4.67E-06 2.47E-07 mr1696_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 2.08E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663282 NA 2.50E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251