\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233663084:

Variant ID: vg0233663084 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33663084
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAACAAAGTTCAAAGCCAATCCAAATCCTAATTTGTAACTAACTTTATACACATAATCAACTCAAACACTAACACAATTTTCTTTTGAAGAATCTAAC[A/C]
TGAAAATTTTAAATCAAGAATCGGGAAAGATTCAACTTATTAAAAAGTGATAAATTTGAAGAAAATTAATACCACCTTATTTGAATATGTTACAAATTAT

Reverse complement sequence

ATAATTTGTAACATATTCAAATAAGGTGGTATTAATTTTCTTCAAATTTATCACTTTTTAATAAGTTGAATCTTTCCCGATTCTTGATTTAAAATTTTCA[T/G]
GTTAGATTCTTCAAAAGAAAATTGTGTTAGTGTTTGAGTTGATTATGTGTATAAAGTTAGTTACAAATTAGGATTTGGATTGGCTTTGAACTTTGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 9.70% 0.70% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 73.90% 24.00% 2.05% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 78.40% 18.60% 3.00% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 38.20% 58.50% 3.32% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233663084 A -> C LOC_Os02g54950.1 upstream_gene_variant ; 1099.0bp to feature; MODIFIER silent_mutation Average:18.381; most accessible tissue: Callus, score: 40.183 N N N N
vg0233663084 A -> C LOC_Os02g54960.1 upstream_gene_variant ; 471.0bp to feature; MODIFIER silent_mutation Average:18.381; most accessible tissue: Callus, score: 40.183 N N N N
vg0233663084 A -> C LOC_Os02g54950-LOC_Os02g54960 intergenic_region ; MODIFIER silent_mutation Average:18.381; most accessible tissue: Callus, score: 40.183 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233663084 5.46E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 1.91E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 3.07E-08 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 2.78E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 9.28E-08 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 3.35E-08 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 2.81E-09 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 2.33E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 2.97E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 6.08E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084 NA 3.39E-08 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251