RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0233663084:

Variant ID: vg0233663084 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33663084
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAACAAAGTTCAAAGCCAATCCAAATCCTAATTTGTAACTAACTTTATACACATAATCAACTCAAACACTAACACAATTTTCTTTTGAAGAATCTAAC[A/C]
TGAAAATTTTAAATCAAGAATCGGGAAAGATTCAACTTATTAAAAAGTGATAAATTTGAAGAAAATTAATACCACCTTATTTGAATATGTTACAAATTAT

Reverse complement sequence

ATAATTTGTAACATATTCAAATAAGGTGGTATTAATTTTCTTCAAATTTATCACTTTTTAATAAGTTGAATCTTTCCCGATTCTTGATTTAAAATTTTCA[T/G]
GTTAGATTCTTCAAAAGAAAATTGTGTTAGTGTTTGAGTTGATTATGTGTATAAAGTTAGTTACAAATTAGGATTTGGATTGGCTTTGAACTTTGTTTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	9.70%	0.70%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	73.90%	24.00%	2.05%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	78.40%	18.60%	3.00%	0.00%	NA
Tropical Japonica	504	84.30%	15.70%	0.00%	0.00%	NA
Japonica Intermediate	241	38.20%	58.50%	3.32%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233663084	A -> C	LOC_Os02g54950.1	upstream_gene_variant ; 1099.0bp to feature; MODIFIER	silent_mutation	Average:18.381; most accessible tissue: Callus, score: 40.183	N	N	N	N
vg0233663084	A -> C	LOC_Os02g54960.1	upstream_gene_variant ; 471.0bp to feature; MODIFIER	silent_mutation	Average:18.381; most accessible tissue: Callus, score: 40.183	N	N	N	N
vg0233663084	A -> C	LOC_Os02g54950-LOC_Os02g54960	intergenic_region ; MODIFIER	silent_mutation	Average:18.381; most accessible tissue: Callus, score: 40.183	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233663084	5.46E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	1.91E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	3.07E-08	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	2.78E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	9.28E-08	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	3.35E-08	NA	mr1203_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	2.81E-09	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	2.33E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	2.97E-07	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233663084	NA	6.08E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0233663084:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact