Variant ID: vg0233663084 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 33663084 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 232. )
TCAAACAAAGTTCAAAGCCAATCCAAATCCTAATTTGTAACTAACTTTATACACATAATCAACTCAAACACTAACACAATTTTCTTTTGAAGAATCTAAC[A/C]
TGAAAATTTTAAATCAAGAATCGGGAAAGATTCAACTTATTAAAAAGTGATAAATTTGAAGAAAATTAATACCACCTTATTTGAATATGTTACAAATTAT
ATAATTTGTAACATATTCAAATAAGGTGGTATTAATTTTCTTCAAATTTATCACTTTTTAATAAGTTGAATCTTTCCCGATTCTTGATTTAAAATTTTCA[T/G]
GTTAGATTCTTCAAAAGAAAATTGTGTTAGTGTTTGAGTTGATTATGTGTATAAAGTTAGTTACAAATTAGGATTTGGATTGGCTTTGAACTTTGTTTGA
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.60% | 9.70% | 0.70% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 73.90% | 24.00% | 2.05% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 78.40% | 18.60% | 3.00% | 0.00% | NA |
Tropical Japonica | 504 | 84.30% | 15.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 38.20% | 58.50% | 3.32% | 0.00% | NA |
VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 83.30% | 14.40% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0233663084 | A -> C | LOC_Os02g54950.1 | upstream_gene_variant ; 1099.0bp to feature; MODIFIER | silent_mutation | Average:18.381; most accessible tissue: Callus, score: 40.183 | N | N | N | N |
vg0233663084 | A -> C | LOC_Os02g54960.1 | upstream_gene_variant ; 471.0bp to feature; MODIFIER | silent_mutation | Average:18.381; most accessible tissue: Callus, score: 40.183 | N | N | N | N |
vg0233663084 | A -> C | LOC_Os02g54950-LOC_Os02g54960 | intergenic_region ; MODIFIER | silent_mutation | Average:18.381; most accessible tissue: Callus, score: 40.183 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0233663084 | 5.46E-07 | NA | mr1071_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 1.91E-08 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 3.07E-08 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | 2.78E-06 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 9.28E-08 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | 3.35E-08 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 2.81E-09 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 2.33E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 2.97E-07 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 6.08E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233663084 | NA | 3.39E-08 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |