\
| Variant ID: vg0233656481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33656481 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTATATGGTCGATAGTTTTGTTCTAGGATTATCTTAAGATTATTATAAGCTATAGTCAGTTAGTGGTGGCCCCGGTAACTATTTTTCCTGGCTTCGCC[C/T]
CTGCTACTACCGATTAATTAAACCTATAAATCAGCTCTGAACATAATGGTGCCAGTTTCCTACGCAATAAACTATTAGTGAACATAGAGCATCACCATTC
GAATGGTGATGCTCTATGTTCACTAATAGTTTATTGCGTAGGAAACTGGCACCATTATGTTCAGAGCTGATTTATAGGTTTAATTAATCGGTAGTAGCAG[G/A]
GGCGAAGCCAGGAAAAATAGTTACCGGGGCCACCACTAACTGACTATAGCTTATAATAATCTTAAGATAATCCTAGAACAAAACTATCGACCATATAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.70% | 4.60% | 5.12% | 59.61% | NA |
| All Indica | 2759 | 2.30% | 0.10% | 6.13% | 91.41% | NA |
| All Japonica | 1512 | 84.30% | 12.40% | 1.85% | 1.46% | NA |
| Aus | 269 | 2.20% | 0.40% | 13.01% | 84.39% | NA |
| Indica I | 595 | 1.00% | 0.00% | 5.88% | 93.11% | NA |
| Indica II | 465 | 3.40% | 0.20% | 5.59% | 90.75% | NA |
| Indica III | 913 | 1.50% | 0.10% | 5.04% | 93.32% | NA |
| Indica Intermediate | 786 | 3.60% | 0.30% | 7.89% | 88.30% | NA |
| Temperate Japonica | 767 | 94.00% | 2.90% | 1.69% | 1.43% | NA |
| Tropical Japonica | 504 | 85.70% | 13.30% | 0.79% | 0.20% | NA |
| Japonica Intermediate | 241 | 50.60% | 40.70% | 4.56% | 4.15% | NA |
| VI/Aromatic | 96 | 61.50% | 20.80% | 3.12% | 14.58% | NA |
| Intermediate | 90 | 50.00% | 6.70% | 7.78% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233656481 | C -> T | LOC_Os02g54950.1 | downstream_gene_variant ; 3943.0bp to feature; MODIFIER | silent_mutation | Average:10.768; most accessible tissue: Callus, score: 69.821 | N | N | N | N |
| vg0233656481 | C -> T | LOC_Os02g54940-LOC_Os02g54950 | intergenic_region ; MODIFIER | silent_mutation | Average:10.768; most accessible tissue: Callus, score: 69.821 | N | N | N | N |
| vg0233656481 | C -> DEL | N | N | silent_mutation | Average:10.768; most accessible tissue: Callus, score: 69.821 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233656481 | NA | 2.31E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233656481 | NA | 4.81E-07 | mr1496 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233656481 | NA | 1.36E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233656481 | NA | 5.32E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233656481 | NA | 1.12E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233656481 | NA | 4.35E-08 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |