\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233608236:

Variant ID: vg0233608236 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33608236
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 368. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTGAGAATTATTCAGAGTTGTCTTCGCAAACAGCTAGCTTAGCTAGGGAATATTGCATGCAATCAAGCACAGTTTCGAACGATCAAGCCAGTGAGGA[A/G]
CAGTGCTACTAATCGAACAAAAATGGCACTGCACAGTGGTAGCCAGGACCAAGCTGCGATCGAGTATTGTACTGTACACTCTCTGTACACGGCGAGTTTA

Reverse complement sequence

TAAACTCGCCGTGTACAGAGAGTGTACAGTACAATACTCGATCGCAGCTTGGTCCTGGCTACCACTGTGCAGTGCCATTTTTGTTCGATTAGTAGCACTG[T/C]
TCCTCACTGGCTTGATCGTTCGAAACTGTGCTTGATTGCATGCAATATTCCCTAGCTAAGCTAGCTGTTTGCGAAGACAACTCTGAATAATTCTCACATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 11.30% 1.04% 0.00% NA
All Indica  2759 99.50% 0.50% 0.00% 0.00% NA
All Japonica  1512 65.00% 31.90% 3.04% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 78.40% 16.70% 4.95% 0.00% NA
Tropical Japonica  504 39.30% 59.70% 0.99% 0.00% NA
Japonica Intermediate  241 76.30% 22.40% 1.24% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 82.20% 14.40% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233608236 A -> G LOC_Os02g54870.1 downstream_gene_variant ; 2234.0bp to feature; MODIFIER silent_mutation Average:94.449; most accessible tissue: Minghui63 flower, score: 98.533 N N N N
vg0233608236 A -> G LOC_Os02g54880.1 intron_variant ; MODIFIER silent_mutation Average:94.449; most accessible tissue: Minghui63 flower, score: 98.533 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0233608236 A G 0.04 -0.04 -0.01 -0.02 -0.03 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233608236 5.43E-07 NA mr1140 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 4.02E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 1.36E-07 NA mr1613 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 8.97E-08 NA mr1613 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 2.98E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 3.29E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 2.66E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 NA 8.18E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 NA 2.90E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 1.17E-06 NA mr1913_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233608236 3.55E-06 NA mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251