Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0233606717:

Variant ID: vg0233606717 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33606717
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTAGCAATTAGGCTTAAAAGATTTCTCGCAATTTACATGTAATCTATAATTAGTTATTTTTTTTATATTTAATAATGTATACATGTGTCTAAATATTC[G/A]
ATGTGATAGGGTGAAAATTTTTATTAGAGGATCTAAACATGCCCTAATTACAATATTCTTTCTGACGTCCATTGACAGTCAGAGCCTACCCACAGTCCAG

Reverse complement sequence

CTGGACTGTGGGTAGGCTCTGACTGTCAATGGACGTCAGAAAGAATATTGTAATTAGGGCATGTTTAGATCCTCTAATAAAAATTTTCACCCTATCACAT[C/T]
GAATATTTAGACACATGTATACATTATTAAATATAAAAAAAATAACTAATTATAGATTACATGTAAATTGCGAGAAATCTTTTAAGCCTAATTGCTACAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 33.60% 0.83% 0.00% NA
All Indica  2759 99.00% 1.00% 0.04% 0.00% NA
All Japonica  1512 2.70% 94.80% 2.45% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.13% 0.00% NA
Temperate Japonica  767 4.20% 91.90% 3.91% 0.00% NA
Tropical Japonica  504 0.20% 99.40% 0.40% 0.00% NA
Japonica Intermediate  241 3.30% 94.60% 2.07% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233606717 G -> A LOC_Os02g54870.1 downstream_gene_variant ; 715.0bp to feature; MODIFIER silent_mutation Average:71.321; most accessible tissue: Callus, score: 88.206 N N N N
vg0233606717 G -> A LOC_Os02g54880.1 downstream_gene_variant ; 1317.0bp to feature; MODIFIER silent_mutation Average:71.321; most accessible tissue: Callus, score: 88.206 N N N N
vg0233606717 G -> A LOC_Os02g54870-LOC_Os02g54880 intergenic_region ; MODIFIER silent_mutation Average:71.321; most accessible tissue: Callus, score: 88.206 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0233606717 G A -0.04 -0.07 -0.04 -0.03 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233606717 NA 1.16E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 6.07E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 8.03E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 2.04E-07 2.03E-07 mr1343 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 8.97E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 1.99E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 2.53E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 2.39E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 3.54E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 2.50E-08 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 2.42E-24 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 1.45E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 1.03E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 1.79E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233606717 NA 5.97E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251