\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233282809:

Variant ID: vg0233282809 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33282809
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGCAACAGATGAAGCAGTTTGTAGCTGATTTTCAAATGCGTTGTCTTCAATGTTTCATCATGACACCAGAAGGGCCAACTCAGAAGACTCAATTTCCC[A/T]
AGCCGATAGTTGAAATACTTCAAGATACAGTTGATGACGCAGTTCATCGCGCATTGTTTAATCAATCTGGAGTTTTGGCGGATACATTACAAAATTTGAT

Reverse complement sequence

ATCAAATTTTGTAATGTATCCGCCAAAACTCCAGATTGATTAAACAATGCGCGATGAACTGCGTCATCAACTGTATCTTGAAGTATTTCAACTATCGGCT[T/A]
GGGAAATTGAGTCTTCTGAGTTGGCCCTTCTGGTGTCATGATGAAACATTGAAGACAACGCATTTGAAAATCAGCTACAAACTGCTTCATCTGTTGCCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 0.60% 12.06% 28.57% NA
All Indica  2759 31.50% 0.70% 19.90% 47.99% NA
All Japonica  1512 99.40% 0.10% 0.13% 0.40% NA
Aus  269 94.10% 0.00% 4.09% 1.86% NA
Indica I  595 22.90% 1.00% 12.77% 63.36% NA
Indica II  465 19.80% 0.90% 17.42% 61.94% NA
Indica III  913 38.30% 0.00% 26.40% 35.27% NA
Indica Intermediate  786 36.90% 1.00% 19.21% 42.88% NA
Temperate Japonica  767 99.50% 0.00% 0.13% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 86.50% 8.30% 4.17% 1.04% NA
Intermediate  90 78.90% 1.10% 4.44% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233282809 A -> T LOC_Os02g54270.1 downstream_gene_variant ; 4001.0bp to feature; MODIFIER silent_mutation Average:15.929; most accessible tissue: Callus, score: 25.292 N N N N
vg0233282809 A -> T LOC_Os02g54280.1 intron_variant ; MODIFIER silent_mutation Average:15.929; most accessible tissue: Callus, score: 25.292 N N N N
vg0233282809 A -> DEL N N silent_mutation Average:15.929; most accessible tissue: Callus, score: 25.292 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233282809 NA 2.38E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 2.80E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 8.67E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 4.76E-19 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 1.42E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 4.05E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 4.42E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 5.44E-22 mr1239_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 3.83E-19 mr1276_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 1.71E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 1.13E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 9.71E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809 NA 9.16E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251