Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233282809:

Variant ID: vg0233282809 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33282809
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGCAACAGATGAAGCAGTTTGTAGCTGATTTTCAAATGCGTTGTCTTCAATGTTTCATCATGACACCAGAAGGGCCAACTCAGAAGACTCAATTTCCC[A/T]
AGCCGATAGTTGAAATACTTCAAGATACAGTTGATGACGCAGTTCATCGCGCATTGTTTAATCAATCTGGAGTTTTGGCGGATACATTACAAAATTTGAT

Reverse complement sequence

ATCAAATTTTGTAATGTATCCGCCAAAACTCCAGATTGATTAAACAATGCGCGATGAACTGCGTCATCAACTGTATCTTGAAGTATTTCAACTATCGGCT[T/A]
GGGAAATTGAGTCTTCTGAGTTGGCCCTTCTGGTGTCATGATGAAACATTGAAGACAACGCATTTGAAAATCAGCTACAAACTGCTTCATCTGTTGCCTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	0.60%	12.06%	28.57%	NA
All Indica	2759	31.50%	0.70%	19.90%	47.99%	NA
All Japonica	1512	99.40%	0.10%	0.13%	0.40%	NA
Aus	269	94.10%	0.00%	4.09%	1.86%	NA
Indica I	595	22.90%	1.00%	12.77%	63.36%	NA
Indica II	465	19.80%	0.90%	17.42%	61.94%	NA
Indica III	913	38.30%	0.00%	26.40%	35.27%	NA
Indica Intermediate	786	36.90%	1.00%	19.21%	42.88%	NA
Temperate Japonica	767	99.50%	0.00%	0.13%	0.39%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	0.40%	0.41%	1.24%	NA
VI/Aromatic	96	86.50%	8.30%	4.17%	1.04%	NA
Intermediate	90	78.90%	1.10%	4.44%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233282809	A -> T	LOC_Os02g54270.1	downstream_gene_variant ; 4001.0bp to feature; MODIFIER	silent_mutation	Average:15.929; most accessible tissue: Callus, score: 25.292	N	N	N	N
vg0233282809	A -> T	LOC_Os02g54280.1	intron_variant ; MODIFIER	silent_mutation	Average:15.929; most accessible tissue: Callus, score: 25.292	N	N	N	N
vg0233282809	A -> DEL	N	N	silent_mutation	Average:15.929; most accessible tissue: Callus, score: 25.292	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233282809	NA	2.38E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	2.80E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	8.67E-15	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	4.76E-19	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	1.42E-32	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	4.05E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	4.42E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	5.44E-22	mr1239_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	3.83E-19	mr1276_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	1.71E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	1.13E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	9.71E-10	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233282809	NA	9.16E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251