\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233254450:

Variant ID: vg0233254450 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33254450
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


ATGCACTTGAACAGTTCTCTGGAATCTGTGTCTCCTCATATAATCCCAAGAACCTAGCCAAGAGATGATGTATTGTCACTTCTAAATTACCAGCAAAATA[T/G]
CCATGCTTTGCTATGGGTAAAAGAAAATATATAATAATATGTCATAGAGATGTTTGCTTATTTGAATACATGATATTCACTTGATTGAAACAAATATTAG

Reverse complement sequence

CTAATATTTGTTTCAATCAAGTGAATATCATGTATTCAAATAAGCAAACATCTCTATGACATATTATTATATATTTTCTTTTACCCATAGCAAAGCATGG[A/C]
TATTTTGCTGGTAATTTAGAAGTGACAATACATCATCTCTTGGCTAGGTTCTTGGGATTATATGAGGAGACACAGATTCCAGAGAACTGTTCAAGTGCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 11.10% 1.50% 0.00% NA
All Indica  2759 99.60% 0.30% 0.11% 0.00% NA
All Japonica  1512 62.40% 33.30% 4.30% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.60% 0.25% 0.00% NA
Temperate Japonica  767 35.90% 57.90% 6.26% 0.00% NA
Tropical Japonica  504 97.20% 1.80% 0.99% 0.00% NA
Japonica Intermediate  241 73.90% 21.20% 4.98% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 12.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233254450 T -> G LOC_Os02g54240.1 downstream_gene_variant ; 3348.0bp to feature; MODIFIER silent_mutation Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535 N N N N
vg0233254450 T -> G LOC_Os02g54254.1 intron_variant ; MODIFIER silent_mutation Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535 N N N N
vg0233254450 T -> G LOC_Os02g54254.2 intron_variant ; MODIFIER silent_mutation Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233254450 2.77E-06 2.49E-08 mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233254450 NA 7.90E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251