Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0233254450:

Variant ID: vg0233254450 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33254450
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

ATGCACTTGAACAGTTCTCTGGAATCTGTGTCTCCTCATATAATCCCAAGAACCTAGCCAAGAGATGATGTATTGTCACTTCTAAATTACCAGCAAAATA[T/G]
CCATGCTTTGCTATGGGTAAAAGAAAATATATAATAATATGTCATAGAGATGTTTGCTTATTTGAATACATGATATTCACTTGATTGAAACAAATATTAG

Reverse complement sequence

CTAATATTTGTTTCAATCAAGTGAATATCATGTATTCAAATAAGCAAACATCTCTATGACATATTATTATATATTTTCTTTTACCCATAGCAAAGCATGG[A/C]
TATTTTGCTGGTAATTTAGAAGTGACAATACATCATCTCTTGGCTAGGTTCTTGGGATTATATGAGGAGACACAGATTCCAGAGAACTGTTCAAGTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.40%	11.10%	1.50%	0.00%	NA
All Indica	2759	99.60%	0.30%	0.11%	0.00%	NA
All Japonica	1512	62.40%	33.30%	4.30%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.60%	0.25%	0.00%	NA
Temperate Japonica	767	35.90%	57.90%	6.26%	0.00%	NA
Tropical Japonica	504	97.20%	1.80%	0.99%	0.00%	NA
Japonica Intermediate	241	73.90%	21.20%	4.98%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	12.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233254450	T -> G	LOC_Os02g54240.1	downstream_gene_variant ; 3348.0bp to feature; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535	N	N	N	N
vg0233254450	T -> G	LOC_Os02g54254.1	intron_variant ; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535	N	N	N	N
vg0233254450	T -> G	LOC_Os02g54254.2	intron_variant ; MODIFIER	silent_mutation	Average:71.596; most accessible tissue: Minghui63 flower, score: 86.535	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233254450	2.77E-06	2.49E-08	mr1977_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233254450	NA	7.90E-06	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251