\
| Variant ID: vg0233244719 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33244719 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 300. )
CCGTTGGACTTCACATGGTGTTCTCGACTATGTCCTGTCTCTACGGTTCCCACACCGAGAACGACATCAGCTTCGACATCAGAAGTCGCGTTGGTCACAC[G/A]
AGTTCATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATATGTCACATATCAATATGGCATGCCTGCG
CGCAGGCATGCCATATTGATATGTGACATATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATGAACT[C/T]
GTGTGACCAACGCGACTTCTGATGTCGAAGCTGATGTCGTTCTCGGTGTGGGAACCGTAGAGACAGGACATAGTCGAGAACACCATGTGAAGTCCAACGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 5.40% | 0.19% | 0.59% | NA |
| All Indica | 2759 | 97.30% | 2.30% | 0.07% | 0.29% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 24.20% | 66.90% | 2.23% | 6.69% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.30% | 0.22% | 0.44% | NA |
| Indica Intermediate | 786 | 95.50% | 3.90% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233244719 | G -> A | LOC_Os02g54220.1 | upstream_gene_variant ; 360.0bp to feature; MODIFIER | silent_mutation | Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0233244719 | G -> A | LOC_Os02g54210.1 | downstream_gene_variant ; 3750.0bp to feature; MODIFIER | silent_mutation | Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0233244719 | G -> A | LOC_Os02g54230.1 | downstream_gene_variant ; 1396.0bp to feature; MODIFIER | silent_mutation | Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0233244719 | G -> A | LOC_Os02g54220-LOC_Os02g54230 | intergenic_region ; MODIFIER | silent_mutation | Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg0233244719 | G -> DEL | N | N | silent_mutation | Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233244719 | NA | 4.06E-39 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233244719 | NA | 7.32E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233244719 | 4.70E-06 | NA | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233244719 | NA | 8.03E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |