\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233244719:

Variant ID: vg0233244719 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33244719
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTGGACTTCACATGGTGTTCTCGACTATGTCCTGTCTCTACGGTTCCCACACCGAGAACGACATCAGCTTCGACATCAGAAGTCGCGTTGGTCACAC[G/A]
AGTTCATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATATGTCACATATCAATATGGCATGCCTGCG

Reverse complement sequence

CGCAGGCATGCCATATTGATATGTGACATATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATGAACT[C/T]
GTGTGACCAACGCGACTTCTGATGTCGAAGCTGATGTCGTTCTCGGTGTGGGAACCGTAGAGACAGGACATAGTCGAGAACACCATGTGAAGTCCAACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 5.40% 0.19% 0.59% NA
All Indica  2759 97.30% 2.30% 0.07% 0.29% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 24.20% 66.90% 2.23% 6.69% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 96.10% 3.30% 0.22% 0.44% NA
Indica Intermediate  786 95.50% 3.90% 0.00% 0.51% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233244719 G -> A LOC_Os02g54220.1 upstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0233244719 G -> A LOC_Os02g54210.1 downstream_gene_variant ; 3750.0bp to feature; MODIFIER silent_mutation Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0233244719 G -> A LOC_Os02g54230.1 downstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0233244719 G -> A LOC_Os02g54220-LOC_Os02g54230 intergenic_region ; MODIFIER silent_mutation Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg0233244719 G -> DEL N N silent_mutation Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233244719 NA 4.06E-39 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719 NA 7.32E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719 4.70E-06 NA mr1509_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719 NA 8.03E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251