Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233244719:

Variant ID: vg0233244719 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33244719
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CCGTTGGACTTCACATGGTGTTCTCGACTATGTCCTGTCTCTACGGTTCCCACACCGAGAACGACATCAGCTTCGACATCAGAAGTCGCGTTGGTCACAC[G/A]
AGTTCATTTAAGCAGAAGTCGGGGGCTACTGTCAGGGTTACGGGTTAGGTATACCCTTTACCCTTCGATATATGTCACATATCAATATGGCATGCCTGCG

Reverse complement sequence

CGCAGGCATGCCATATTGATATGTGACATATATCGAAGGGTAAAGGGTATACCTAACCCGTAACCCTGACAGTAGCCCCCGACTTCTGCTTAAATGAACT[C/T]
GTGTGACCAACGCGACTTCTGATGTCGAAGCTGATGTCGTTCTCGGTGTGGGAACCGTAGAGACAGGACATAGTCGAGAACACCATGTGAAGTCCAACGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	5.40%	0.19%	0.59%	NA
All Indica	2759	97.30%	2.30%	0.07%	0.29%	NA
All Japonica	1512	99.80%	0.10%	0.00%	0.07%	NA
Aus	269	24.20%	66.90%	2.23%	6.69%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	96.10%	3.30%	0.22%	0.44%	NA
Indica Intermediate	786	95.50%	3.90%	0.00%	0.51%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233244719	G -> A	LOC_Os02g54220.1	upstream_gene_variant ; 360.0bp to feature; MODIFIER	silent_mutation	Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0233244719	G -> A	LOC_Os02g54210.1	downstream_gene_variant ; 3750.0bp to feature; MODIFIER	silent_mutation	Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0233244719	G -> A	LOC_Os02g54230.1	downstream_gene_variant ; 1396.0bp to feature; MODIFIER	silent_mutation	Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0233244719	G -> A	LOC_Os02g54220-LOC_Os02g54230	intergenic_region ; MODIFIER	silent_mutation	Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N
vg0233244719	G -> DEL	N	N	silent_mutation	Average:51.642; most accessible tissue: Minghui63 flag leaf, score: 67.635	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233244719	NA	4.06E-39	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719	NA	7.32E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719	4.70E-06	NA	mr1509_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233244719	NA	8.03E-06	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251