RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0233123079:

Variant ID: vg0233123079 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33123079
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTTGCTTACCAATATGATATTTTTCATGAATATTGGCATGGTATGAAATGGTTTACTAATGAGTAATCATCGTTGATGAACTGTGTAGATTGTCGC[A/G]
ATGCAATTATTGGGGTTGTCTGGTCATTTTGGTCTTGGAAACACCAATAACCTTGCCAGCATTGATGTTGCTGGAGCTTTCATTGTAAGTTTAACAAAGA

Reverse complement sequence

TCTTTGTTAAACTTACAATGAAAGCTCCAGCAACATCAATGCTGGCAAGGTTATTGGTGTTTCCAAGACCAAAATGACCAGACAACCCCAATAATTGCAT[T/C]
GCGACAATCTACACAGTTCATCAACGATGATTACTCATTAGTAAACCATTTCATACCATGCCAATATTCATGAAAAATATCATATTGGTAAGCAAATATT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.30%	13.70%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	58.70%	41.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.10%	0.00%	0.00%	NA
Temperate Japonica	767	26.70%	73.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	76.30%	23.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233123079	A -> G	LOC_Os02g54080.1	downstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:54.362; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0233123079	A -> G	LOC_Os02g54080.2	downstream_gene_variant ; 1336.0bp to feature; MODIFIER	silent_mutation	Average:54.362; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N
vg0233123079	A -> G	LOC_Os02g54060-LOC_Os02g54080	intergenic_region ; MODIFIER	silent_mutation	Average:54.362; most accessible tissue: Minghui63 flower, score: 67.065	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233123079	1.81E-08	NA	Awn_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0233123079	9.10E-07	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	NA	9.69E-11	mr1368	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	NA	6.42E-06	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	NA	6.22E-10	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	9.31E-10	NA	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	3.16E-07	NA	mr1829	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	8.63E-06	NA	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	NA	7.98E-08	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233123079	NA	1.41E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 17 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0233123079:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact