| Variant ID: vg0233059202 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 33059202 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAACCCATAACGGTTTAACAAACCGTTGGGAGTGTGATTACCGCCATCTTATAATTTAGAAAATTACATGATTACCGCGAGGTATACTATCTTTTAAAAA[A/G]
CTGAAAATGTTACCACACATGATAACCGCGACAACCTAAGGATATCTTCAGGGCAAGTAAAACGAAATACATATTATTGTATGATTAGTTAAGTATTAAC
GTTAATACTTAACTAATCATACAATAATATGTATTTCGTTTTACTTGCCCTGAAGATATCCTTAGGTTGTCGCGGTTATCATGTGTGGTAACATTTTCAG[T/C]
TTTTTAAAAGATAGTATACCTCGCGGTAATCATGTAATTTTCTAAATTATAAGATGGCGGTAATCACACTCCCAACGGTTTGTTAAACCGTTATGGGTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.20% | 5.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 12.20% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 50.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0233059202 | A -> G | LOC_Os02g53990.1 | intron_variant ; MODIFIER | silent_mutation | Average:59.394; most accessible tissue: Callus, score: 89.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0233059202 | NA | 4.22E-07 | mr1064 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 1.72E-06 | mr1534 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 1.74E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | 3.58E-09 | 9.07E-13 | mr1693 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 4.35E-06 | mr1720 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 4.04E-08 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 1.78E-08 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 4.92E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 1.33E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0233059202 | NA | 3.60E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/