Variant ID: vg0233028845 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 33028845 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATAAACTTTTAGTATATAATAGATTTGAATGAAAATCAACGGTAGATTAAATAGTGCCACATAGCAGTTTAGAAGCGTTTATAGGAATGTCACGTGACG[T/C]
ATTGGGAGTGTTTGTAGGAAGTTTAATGTACTTTTAGTATATATAATAGATAGATAGATAGATAGATTGGCAGTGATCGACCTTGTGTAAGCTTGCAATA
TATTGCAAGCTTACACAAGGTCGATCACTGCCAATCTATCTATCTATCTATCTATTATATATACTAAAAGTACATTAAACTTCCTACAAACACTCCCAAT[A/G]
CGTCACGTGACATTCCTATAAACGCTTCTAAACTGCTATGTGGCACTATTTAATCTACCGTTGATTTTCATTCAAATCTATTATATACTAAAAGTTTATT
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.50% | 7.40% | 0.13% | 0.00% | NA |
All Indica | 2759 | 98.90% | 1.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 83.80% | 15.90% | 0.33% | 0.00% | NA |
Aus | 269 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 69.60% | 30.00% | 0.39% | 0.00% | NA |
Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0233028845 | T -> C | LOC_Os02g53940.1 | upstream_gene_variant ; 4899.0bp to feature; MODIFIER | silent_mutation | Average:44.075; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
vg0233028845 | T -> C | LOC_Os02g53940-LOC_Os02g53950 | intergenic_region ; MODIFIER | silent_mutation | Average:44.075; most accessible tissue: Zhenshan97 root, score: 82.17 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0233028845 | NA | 1.24E-06 | Yield | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0233028845 | NA | 1.00E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233028845 | NA | 1.02E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233028845 | NA | 2.54E-08 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233028845 | 1.18E-07 | 3.30E-08 | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0233028845 | 2.07E-06 | 1.68E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |