\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233028845:

Variant ID: vg0233028845 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33028845
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATAAACTTTTAGTATATAATAGATTTGAATGAAAATCAACGGTAGATTAAATAGTGCCACATAGCAGTTTAGAAGCGTTTATAGGAATGTCACGTGACG[T/C]
ATTGGGAGTGTTTGTAGGAAGTTTAATGTACTTTTAGTATATATAATAGATAGATAGATAGATAGATTGGCAGTGATCGACCTTGTGTAAGCTTGCAATA

Reverse complement sequence

TATTGCAAGCTTACACAAGGTCGATCACTGCCAATCTATCTATCTATCTATCTATTATATATACTAAAAGTACATTAAACTTCCTACAAACACTCCCAAT[A/G]
CGTCACGTGACATTCCTATAAACGCTTCTAAACTGCTATGTGGCACTATTTAATCTACCGTTGATTTTCATTCAAATCTATTATATACTAAAAGTTTATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.40% 0.13% 0.00% NA
All Indica  2759 98.90% 1.00% 0.04% 0.00% NA
All Japonica  1512 83.80% 15.90% 0.33% 0.00% NA
Aus  269 75.50% 24.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.80% 0.00% 0.00% NA
Temperate Japonica  767 69.60% 30.00% 0.39% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233028845 T -> C LOC_Os02g53940.1 upstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:44.075; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N
vg0233028845 T -> C LOC_Os02g53940-LOC_Os02g53950 intergenic_region ; MODIFIER silent_mutation Average:44.075; most accessible tissue: Zhenshan97 root, score: 82.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233028845 NA 1.24E-06 Yield Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0233028845 NA 1.00E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233028845 NA 1.02E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233028845 NA 2.54E-08 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233028845 1.18E-07 3.30E-08 mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233028845 2.07E-06 1.68E-07 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251