Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233012400:

Variant ID: vg0233012400 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 33012400
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTCGCGTAGGTTTCGGCCGTTTCGTCGATCCGCAGTTCCTCGAAGACGTTGCCGAGGTCTCATCAGTTCGAGAGCAAGGCAAGTCATGCAATACGTTT[G/A]
ATCATACTGTACCCAATTTACAAATATCCCGCATTTCTATTAAATGTTGCATTCTTTTACAATGTAATGTGGGATGGGTCCTATTCCTCAGCCACATATT

Reverse complement sequence

AATATGTGGCTGAGGAATAGGACCCATCCCACATTACATTGTAAAAGAATGCAACATTTAATAGAAATGCGGGATATTTGTAAATTGGGTACAGTATGAT[C/T]
AAACGTATTGCATGACTTGCCTTGCTCTCGAACTGATGAGACCTCGGCAACGTCTTCGAGGAACTGCGGATCGACGAAACGGCCGAAACCTACGCGACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	6.50%	5.21%	1.59%	NA
All Indica	2759	95.80%	0.40%	2.90%	0.87%	NA
All Japonica	1512	80.30%	19.00%	0.60%	0.13%	NA
Aus	269	54.30%	0.00%	43.87%	1.86%	NA
Indica I	595	96.50%	0.20%	3.19%	0.17%	NA
Indica II	465	90.30%	1.70%	5.59%	2.37%	NA
Indica III	913	98.80%	0.20%	0.99%	0.00%	NA
Indica Intermediate	786	95.20%	0.00%	3.31%	1.53%	NA
Temperate Japonica	767	99.50%	0.30%	0.13%	0.13%	NA
Tropical Japonica	504	43.50%	55.40%	1.19%	0.00%	NA
Japonica Intermediate	241	96.30%	2.50%	0.83%	0.41%	NA
VI/Aromatic	96	28.10%	0.00%	31.25%	40.62%	NA
Intermediate	90	74.40%	10.00%	10.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0233012400	G -> A	LOC_Os02g53910.1	upstream_gene_variant ; 1814.0bp to feature; MODIFIER	silent_mutation	Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg0233012400	G -> A	LOC_Os02g53920.1	downstream_gene_variant ; 960.0bp to feature; MODIFIER	silent_mutation	Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg0233012400	G -> A	LOC_Os02g53930.1	downstream_gene_variant ; 3457.0bp to feature; MODIFIER	silent_mutation	Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg0233012400	G -> A	LOC_Os02g53910-LOC_Os02g53920	intergenic_region ; MODIFIER	silent_mutation	Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N
vg0233012400	G -> DEL	N	N	silent_mutation	Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0233012400	NA	2.84E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	8.99E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	5.51E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	1.64E-07	NA	mr1085	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	6.00E-06	NA	mr1103	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	2.51E-07	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	1.90E-07	NA	mr1204	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	5.24E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	2.10E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	1.88E-07	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	2.90E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	4.61E-06	4.61E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	7.22E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	7.37E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	7.76E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	9.59E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	2.78E-07	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	7.92E-06	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	4.47E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	2.10E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	9.21E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400	NA	7.16E-08	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251