\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0233012400:

Variant ID: vg0233012400 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 33012400
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGTCGCGTAGGTTTCGGCCGTTTCGTCGATCCGCAGTTCCTCGAAGACGTTGCCGAGGTCTCATCAGTTCGAGAGCAAGGCAAGTCATGCAATACGTTT[G/A]
ATCATACTGTACCCAATTTACAAATATCCCGCATTTCTATTAAATGTTGCATTCTTTTACAATGTAATGTGGGATGGGTCCTATTCCTCAGCCACATATT

Reverse complement sequence

AATATGTGGCTGAGGAATAGGACCCATCCCACATTACATTGTAAAAGAATGCAACATTTAATAGAAATGCGGGATATTTGTAAATTGGGTACAGTATGAT[C/T]
AAACGTATTGCATGACTTGCCTTGCTCTCGAACTGATGAGACCTCGGCAACGTCTTCGAGGAACTGCGGATCGACGAAACGGCCGAAACCTACGCGACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 6.50% 5.21% 1.59% NA
All Indica  2759 95.80% 0.40% 2.90% 0.87% NA
All Japonica  1512 80.30% 19.00% 0.60% 0.13% NA
Aus  269 54.30% 0.00% 43.87% 1.86% NA
Indica I  595 96.50% 0.20% 3.19% 0.17% NA
Indica II  465 90.30% 1.70% 5.59% 2.37% NA
Indica III  913 98.80% 0.20% 0.99% 0.00% NA
Indica Intermediate  786 95.20% 0.00% 3.31% 1.53% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 43.50% 55.40% 1.19% 0.00% NA
Japonica Intermediate  241 96.30% 2.50% 0.83% 0.41% NA
VI/Aromatic  96 28.10% 0.00% 31.25% 40.62% NA
Intermediate  90 74.40% 10.00% 10.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0233012400 G -> A LOC_Os02g53910.1 upstream_gene_variant ; 1814.0bp to feature; MODIFIER silent_mutation Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg0233012400 G -> A LOC_Os02g53920.1 downstream_gene_variant ; 960.0bp to feature; MODIFIER silent_mutation Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg0233012400 G -> A LOC_Os02g53930.1 downstream_gene_variant ; 3457.0bp to feature; MODIFIER silent_mutation Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg0233012400 G -> A LOC_Os02g53910-LOC_Os02g53920 intergenic_region ; MODIFIER silent_mutation Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N
vg0233012400 G -> DEL N N silent_mutation Average:13.829; most accessible tissue: Minghui63 young leaf, score: 22.423 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0233012400 NA 2.84E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 8.99E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 5.51E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 1.64E-07 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 6.00E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 2.51E-07 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 1.90E-07 NA mr1204 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 5.24E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 2.10E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 1.88E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 2.90E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 4.61E-06 4.61E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 7.22E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 7.37E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 7.76E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 9.59E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 2.78E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 7.92E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 4.47E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 2.10E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 9.21E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0233012400 NA 7.16E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251