Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232958327:

Variant ID: vg0232958327 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32958327
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TTTAGCAACACATCCTAGCAGACAAGTTGGAGATTGACTTTTACATATTTGTCTTAGTAGCAAACGTCTCCAGGAGTAAAAATCGATGCAAAATCATTAT[T/C]
GAGTAATTTATTAGTACTGTCTTCTTATTCGGTTACTTTGTTCTATTGGCAGGTTATACTGGGCTTTCCTCCTGATAAACTCGTTCTAAAGACATTCGGT

Reverse complement sequence

ACCGAATGTCTTTAGAACGAGTTTATCAGGAGGAAAGCCCAGTATAACCTGCCAATAGAACAAAGTAACCGAATAAGAAGACAGTACTAATAAATTACTC[A/G]
ATAATGATTTTGCATCGATTTTTACTCCTGGAGACGTTTGCTACTAAGACAAATATGTAAAAGTCAATCTCCAACTTGTCTGCTAGGATGTGTTGCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	29.90%	0.40%	0.25%	NA
All Indica	2759	98.80%	1.00%	0.00%	0.25%	NA
All Japonica	1512	10.80%	87.90%	1.12%	0.13%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.40%	2.20%	0.00%	0.43%	NA
Indica III	913	99.00%	0.80%	0.00%	0.22%	NA
Indica Intermediate	786	98.50%	1.10%	0.00%	0.38%	NA
Temperate Japonica	767	20.20%	77.60%	2.22%	0.00%	NA
Tropical Japonica	504	0.00%	99.80%	0.00%	0.20%	NA
Japonica Intermediate	241	3.70%	95.90%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	50.00%	44.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232958327	T -> DEL	N	N	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53800.1	upstream_gene_variant ; 2372.0bp to feature; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53820.1	upstream_gene_variant ; 3635.0bp to feature; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53820.2	upstream_gene_variant ; 3635.0bp to feature; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53790.1	downstream_gene_variant ; 3241.0bp to feature; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53790.2	downstream_gene_variant ; 3252.0bp to feature; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N
vg0232958327	T -> C	LOC_Os02g53810.1	intron_variant ; MODIFIER	silent_mutation	Average:41.686; most accessible tissue: Zhenshan97 flower, score: 59.202	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232958327	NA	4.31E-10	Grain_weight	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0232958327	NA	4.09E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.43E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.07E-10	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.60E-10	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.88E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	3.92E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.13E-08	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.67E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	9.67E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.27E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.20E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.40E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.79E-11	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.03E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.47E-08	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	5.95E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	3.79E-20	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	7.65E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.97E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	1.50E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	3.83E-19	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.05E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.89E-21	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	7.00E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	3.13E-06	3.13E-06	mr1571_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	7.42E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	9.28E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	3.40E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	5.15E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	2.94E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	7.78E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.83E-13	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	7.27E-10	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	3.10E-20	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	4.31E-08	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232958327	NA	5.24E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251