Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0232876236:

Variant ID: vg0232876236 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32876236
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATTTTTTAGTCCACGACTCCACATATCATCTGATAGCAAGGGCTTGTTCAGTTTGCTACCATTTTAAACCTTACCAAGTTTTGATATTGCCAAATTTT[A/G]
GTAAAGTTGTCAAAATTTTGGCAAGGTTAACAAATTTTGACAAGATTTCATATGTACTTTCTAAAATTTAGTAACAAACTAAACGTAGCTAAAATTTTAA

Reverse complement sequence

TTAAAATTTTAGCTACGTTTAGTTTGTTACTAAATTTTAGAAAGTACATATGAAATCTTGTCAAAATTTGTTAACCTTGCCAAAATTTTGACAACTTTAC[T/C]
AAAATTTGGCAATATCAAAACTTGGTAAGGTTTAAAATGGTAGCAAACTGAACAAGCCCTTGCTATCAGATGATATGTGGAGTCGTGGACTAAAAAATGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.00% 23.50% 0.47% 0.00% NA
All Indica  2759 99.20% 0.60% 0.18% 0.00% NA
All Japonica  1512 29.10% 69.80% 1.06% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.25% 0.00% NA
Temperate Japonica  767 40.20% 58.30% 1.56% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 48.10% 50.20% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232876236 A -> G LOC_Os02g53710.1 upstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:94.016; most accessible tissue: Zhenshan97 flower, score: 98.393 N N N N
vg0232876236 A -> G LOC_Os02g53710-LOC_Os02g53720 intergenic_region ; MODIFIER silent_mutation Average:94.016; most accessible tissue: Zhenshan97 flower, score: 98.393 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0232876236 A G -0.02 -0.02 -0.02 -0.03 -0.03 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232876236 NA 2.12E-17 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 1.21E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 1.80E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 4.44E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 2.78E-06 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 9.05E-13 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232876236 NA 1.77E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251