\
| Variant ID: vg0232811799 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32811799 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, C: 0.03, others allele: 0.00, population size: 115. )
TCTTCCAGGAGCAAGTCGGCTATGATGAGTTTTAGGGTTTCGATCTAGTTCCCAAGTCGCGCCTGTGATGAATGGTCCAAGTCTTGGCTTCCGCTTTCCT[A/C]
TTTTGTAATGCAGTTGTGAGCTCGGGGTCTGTCTGCAGCCCATCATGACTGTAATCCTACTCTATAATAAAGAGACCTCTGTTGCTGTGGTATTCAGTTT
AAACTGAATACCACAGCAACAGAGGTCTCTTTATTATAGAGTAGGATTACAGTCATGATGGGCTGCAGACAGACCCCGAGCTCACAACTGCATTACAAAA[T/G]
AGGAAAGCGGAAGCCAAGACTTGGACCATTCATCACAGGCGCGACTTGGGAACTAGATCGAAACCCTAAAACTCATCATAGCCGACTTGCTCCTGGAAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 57.40% | 42.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232811799 | A -> C | LOC_Os02g53640.1 | upstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:48.402; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0232811799 | A -> C | LOC_Os02g53650.1 | upstream_gene_variant ; 382.0bp to feature; MODIFIER | silent_mutation | Average:48.402; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0232811799 | A -> C | LOC_Os02g53630.1 | downstream_gene_variant ; 4072.0bp to feature; MODIFIER | silent_mutation | Average:48.402; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0232811799 | A -> C | LOC_Os02g53640-LOC_Os02g53650 | intergenic_region ; MODIFIER | silent_mutation | Average:48.402; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232811799 | 6.09E-09 | NA | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232811799 | 6.84E-06 | 1.13E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232811799 | NA | 2.02E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |