\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232802493:

Variant ID: vg0232802493 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32802493
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTCAACTTCCAAAAATCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAATAATAGGGCTTTAATTCCGCCGTTTGTTGAGTCGTCTC[G/A]
TTCGCGTGTAGCTTCGAAGCCCGAAGACCCGGAGTGCGCGGATTTCGAGGATCAAGCTCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCATCTTGCAC

Reverse complement sequence

GTGCAAGATGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGAGCTTGATCCTCGAAATCCGCGCACTCCGGGTCTTCGGGCTTCGAAGCTACACGCGAA[C/T]
GAGACGACTCAACAAACGGCGGAATTAAAGCCCTATTATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGATTTTTGGAAGTTGAACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 7.50% 0.02% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 77.20% 22.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 57.20% 42.60% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232802493 G -> A LOC_Os02g53620.1 upstream_gene_variant ; 4148.0bp to feature; MODIFIER silent_mutation Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0232802493 G -> A LOC_Os02g53630.1 upstream_gene_variant ; 2050.0bp to feature; MODIFIER silent_mutation Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N
vg0232802493 G -> A LOC_Os02g53620-LOC_Os02g53630 intergenic_region ; MODIFIER silent_mutation Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232802493 NA 2.28E-07 mr1190 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232802493 NA 3.06E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232802493 2.31E-07 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232802493 NA 7.94E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232802493 NA 4.45E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251