\
| Variant ID: vg0232802493 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32802493 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 277. )
CCGTTCAACTTCCAAAAATCCTCAAATCTCGAGATCTATCTAATGGCACGCTTAGAGGTCAATAATAGGGCTTTAATTCCGCCGTTTGTTGAGTCGTCTC[G/A]
TTCGCGTGTAGCTTCGAAGCCCGAAGACCCGGAGTGCGCGGATTTCGAGGATCAAGCTCAAGATCTCGAGCAAGGCAAGTCACCTTTGATCATCTTGCAC
GTGCAAGATGATCAAAGGTGACTTGCCTTGCTCGAGATCTTGAGCTTGATCCTCGAAATCCGCGCACTCCGGGTCTTCGGGCTTCGAAGCTACACGCGAA[C/T]
GAGACGACTCAACAAACGGCGGAATTAAAGCCCTATTATTGACCTCTAAGCGTGCCATTAGATAGATCTCGAGATTTGAGGATTTTTGGAAGTTGAACGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 7.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 77.20% | 22.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 57.20% | 42.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232802493 | G -> A | LOC_Os02g53620.1 | upstream_gene_variant ; 4148.0bp to feature; MODIFIER | silent_mutation | Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| vg0232802493 | G -> A | LOC_Os02g53630.1 | upstream_gene_variant ; 2050.0bp to feature; MODIFIER | silent_mutation | Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| vg0232802493 | G -> A | LOC_Os02g53620-LOC_Os02g53630 | intergenic_region ; MODIFIER | silent_mutation | Average:27.57; most accessible tissue: Minghui63 flag leaf, score: 36.591 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232802493 | NA | 2.28E-07 | mr1190 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232802493 | NA | 3.06E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232802493 | 2.31E-07 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232802493 | NA | 7.94E-08 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232802493 | NA | 4.45E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |