\
| Variant ID: vg0232791648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32791648 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.25, A: 0.05, others allele: 0.00, population size: 80. )
CAAGAGACTGCATCTCCTCCTGCATAGCTGAGATCCACTTCTCACGGTCTCCAGAAACAACAGCTTCAGTGTATGTGGCTGGCTCAAGAGTATTCTCCAC[T/C]
TGTTCAGCACAACTAAAAGCATAATAAACCATATCACATTCCTCAATAAAACGGACTGGAGCTCCACAACTCCTCTTTGTTCTGCGATGGGCAATAGGTT
AACCTATTGCCCATCGCAGAACAAAGAGGAGTTGTGGAGCTCCAGTCCGTTTTATTGAGGAATGTGATATGGTTTATTATGCTTTTAGTTGTGCTGAACA[A/G]
GTGGAGAATACTCTTGAGCCAGCCACATACACTGAAGCTGTTGTTTCTGGAGACCGTGAGAAGTGGATCTCAGCTATGCAGGAGGAGATGCAGTCTCTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.60% | 26.50% | 1.86% | 0.02% | NA |
| All Indica | 2759 | 96.90% | 1.60% | 1.45% | 0.04% | NA |
| All Japonica | 1512 | 23.10% | 76.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 86.20% | 1.50% | 12.27% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.00% | 0.84% | 0.17% | NA |
| Indica II | 465 | 95.50% | 2.80% | 1.72% | 0.00% | NA |
| Indica III | 913 | 96.70% | 1.90% | 1.42% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 1.00% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 42.50% | 57.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 10.00% | 89.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 47.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232791648 | T -> DEL | LOC_Os02g53610.1 | N | frameshift_variant | Average:9.513; most accessible tissue: Callus, score: 14.769 | N | N | N | N |
| vg0232791648 | T -> C | LOC_Os02g53610.1 | synonymous_variant ; p.Gln463Gln; LOW | synonymous_codon | Average:9.513; most accessible tissue: Callus, score: 14.769 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232791648 | NA | 1.29E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 1.08E-15 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 2.58E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 5.19E-14 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 2.24E-12 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | 2.69E-09 | 1.92E-29 | mr1062_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | 1.63E-06 | 8.95E-10 | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 1.27E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 7.98E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 1.09E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 2.54E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 1.59E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 1.74E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232791648 | NA | 3.82E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |