Variant ID: vg0232704669 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 32704669 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTTGTTTACTGATTCATTTCTTGTGTAATAAAAAGCGCAGAATCATGCCTTGAATCCTATTAAAAAGAAAGATTCAAACAACGCAAAGCATTGTCCTA[T/A]
CGAGTTTTGGTGATTTTGCTCTTAGCGGACAGGATGCATTGGGTAACCGATTTCGTCCAAACCTTCAATAAAAGGCTACAATTCTAGGAGAGAGCTCATC
GATGAGCTCTCTCCTAGAATTGTAGCCTTTTATTGAAGGTTTGGACGAAATCGGTTACCCAATGCATCCTGTCCGCTAAGAGCAAAATCACCAAAACTCG[A/T]
TAGGACAATGCTTTGCGTTGTTTGAATCTTTCTTTTTAATAGGATTCAAGGCATGATTCTGCGCTTTTTATTACACAAGAAATGAATCAGTAAACAACTC
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.10% | 1.80% | 0.06% | 0.00% | NA |
All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 94.30% | 5.60% | 0.13% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 88.30% | 11.50% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 93.80% | 5.80% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0232704669 | T -> A | LOC_Os02g53440.1 | upstream_gene_variant ; 4618.0bp to feature; MODIFIER | silent_mutation | Average:69.285; most accessible tissue: Zhenshan97 flower, score: 79.365 | N | N | N | N |
vg0232704669 | T -> A | LOC_Os02g53450.2 | downstream_gene_variant ; 15.0bp to feature; MODIFIER | silent_mutation | Average:69.285; most accessible tissue: Zhenshan97 flower, score: 79.365 | N | N | N | N |
vg0232704669 | T -> A | LOC_Os02g53450-LOC_Os02g53470 | intergenic_region ; MODIFIER | silent_mutation | Average:69.285; most accessible tissue: Zhenshan97 flower, score: 79.365 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0232704669 | NA | 4.40E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0232704669 | 1.76E-06 | NA | mr1798_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |