Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232699410:

Variant ID: vg0232699410 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32699410
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

GTTCCTTCGCTTGATGGGGGTGATGGATATAGAGCGACCTAATTGATTCGAGCGATAGTTAGCATAGTTAGTGTCTGTTCATAAGCAATTCATTATTTAG[A/G]
TAAAAAATATCATTCTCATAATTTACTTGTTTAATGTGGTAGGTGTTAACACTCTTCTCTACAAAACATAGCGAAACTAATCTTTTATATTTTAGAACGG

Reverse complement sequence

CCGTTCTAAAATATAAAAGATTAGTTTCGCTATGTTTTGTAGAGAAGAGTGTTAACACCTACCACATTAAACAAGTAAATTATGAGAATGATATTTTTTA[T/C]
CTAAATAATGAATTGCTTATGAACAGACACTAACTATGCTAACTATCGCTCGAATCAATTAGGTCGCTCTATATCCATCACCCCCATCAAGCGAAGGAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.50%	49.20%	0.13%	0.19%	NA
All Indica	2759	16.50%	83.20%	0.14%	0.18%	NA
All Japonica	1512	99.50%	0.30%	0.07%	0.07%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	17.60%	81.80%	0.17%	0.34%	NA
Indica II	465	7.10%	92.70%	0.22%	0.00%	NA
Indica III	913	18.40%	81.30%	0.11%	0.22%	NA
Indica Intermediate	786	19.00%	80.80%	0.13%	0.13%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	23.30%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232699410	A -> G	LOC_Os02g53430.1	upstream_gene_variant ; 1825.0bp to feature; MODIFIER	silent_mutation	Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg0232699410	A -> G	LOC_Os02g53450.2	upstream_gene_variant ; 1023.0bp to feature; MODIFIER	silent_mutation	Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg0232699410	A -> G	LOC_Os02g53440.1	intron_variant ; MODIFIER	silent_mutation	Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N
vg0232699410	A -> DEL	N	N	silent_mutation	Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232699410	NA	2.32E-35	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.05E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.06E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	6.29E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	9.37E-14	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.20E-55	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.47E-45	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	6.16E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.46E-17	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.03E-23	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	7.27E-14	mr1189_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.03E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	4.24E-34	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	9.51E-23	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	4.87E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	8.58E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.33E-09	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.20E-16	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	3.16E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	3.78E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.34E-14	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	3.37E-21	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.31E-14	mr1734_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.72E-06	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.62E-07	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	2.72E-18	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410	NA	1.57E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251