\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232699410:

Variant ID: vg0232699410 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32699410
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


GTTCCTTCGCTTGATGGGGGTGATGGATATAGAGCGACCTAATTGATTCGAGCGATAGTTAGCATAGTTAGTGTCTGTTCATAAGCAATTCATTATTTAG[A/G]
TAAAAAATATCATTCTCATAATTTACTTGTTTAATGTGGTAGGTGTTAACACTCTTCTCTACAAAACATAGCGAAACTAATCTTTTATATTTTAGAACGG

Reverse complement sequence

CCGTTCTAAAATATAAAAGATTAGTTTCGCTATGTTTTGTAGAGAAGAGTGTTAACACCTACCACATTAAACAAGTAAATTATGAGAATGATATTTTTTA[T/C]
CTAAATAATGAATTGCTTATGAACAGACACTAACTATGCTAACTATCGCTCGAATCAATTAGGTCGCTCTATATCCATCACCCCCATCAAGCGAAGGAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.50% 49.20% 0.13% 0.19% NA
All Indica  2759 16.50% 83.20% 0.14% 0.18% NA
All Japonica  1512 99.50% 0.30% 0.07% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 17.60% 81.80% 0.17% 0.34% NA
Indica II  465 7.10% 92.70% 0.22% 0.00% NA
Indica III  913 18.40% 81.30% 0.11% 0.22% NA
Indica Intermediate  786 19.00% 80.80% 0.13% 0.13% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 23.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232699410 A -> G LOC_Os02g53430.1 upstream_gene_variant ; 1825.0bp to feature; MODIFIER silent_mutation Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0232699410 A -> G LOC_Os02g53450.2 upstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0232699410 A -> G LOC_Os02g53440.1 intron_variant ; MODIFIER silent_mutation Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N
vg0232699410 A -> DEL N N silent_mutation Average:59.761; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232699410 NA 2.32E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.05E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.06E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 6.29E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 9.37E-14 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.20E-55 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.47E-45 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 6.16E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.46E-17 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.03E-23 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 7.27E-14 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.03E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 4.24E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 9.51E-23 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 4.87E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 8.58E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.33E-09 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.20E-16 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 3.16E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 3.78E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.34E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 3.37E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.31E-14 mr1734_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.72E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.62E-07 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 2.72E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232699410 NA 1.57E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251