\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232697844:

Variant ID: vg0232697844 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32697844
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAACTTTCGTATAGAAACTTTTTTAAAAAAACGTATTGTTTAGCAGTTTGAAAAGCGTGCGCGCGGAAAACGCCGAACACACCCATATGTGTTTTTT[T/A]
AAAAAAACAAATGGTTGACAGTTTGGAAATAAATATTACACTTCACCATTTTATTGTACTCTATCTGTCCTAAAATATAAGAATCTATAATTGGATAGGA

Reverse complement sequence

TCCTATCCAATTATAGATTCTTATATTTTAGGACAGATAGAGTACAATAAAATGGTGAAGTGTAATATTTATTTCCAAACTGTCAACCATTTGTTTTTTT[A/T]
AAAAAACACATATGGGTGTGTTCGGCGTTTTCCGCGCGCACGCTTTTCAAACTGCTAAACAATACGTTTTTTTAAAAAAGTTTCTATACGAAAGTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 36.50% 1.84% 12.42% NA
All Indica  2759 83.40% 3.20% 2.83% 10.66% NA
All Japonica  1512 0.30% 98.90% 0.07% 0.73% NA
Aus  269 0.40% 28.60% 1.86% 69.14% NA
Indica I  595 82.40% 0.50% 3.36% 13.78% NA
Indica II  465 92.90% 2.20% 4.30% 0.65% NA
Indica III  913 81.30% 3.40% 1.64% 13.69% NA
Indica Intermediate  786 80.90% 5.50% 2.93% 10.69% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 0.00% 99.80% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 95.40% 0.00% 4.15% NA
VI/Aromatic  96 1.00% 14.60% 0.00% 84.38% NA
Intermediate  90 23.30% 56.70% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232697844 T -> A LOC_Os02g53420.1 upstream_gene_variant ; 4800.0bp to feature; MODIFIER silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0232697844 T -> A LOC_Os02g53430.1 upstream_gene_variant ; 259.0bp to feature; MODIFIER silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0232697844 T -> A LOC_Os02g53450.2 upstream_gene_variant ; 2589.0bp to feature; MODIFIER silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0232697844 T -> A LOC_Os02g53440.1 downstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0232697844 T -> A LOC_Os02g53430-LOC_Os02g53440 intergenic_region ; MODIFIER silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0232697844 T -> DEL N N silent_mutation Average:61.221; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232697844 NA 2.36E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 6.73E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.69E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.18E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.11E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 5.25E-57 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 3.85E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 3.58E-45 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.75E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 7.56E-18 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.11E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.87E-24 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.44E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.19E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.88E-34 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 8.23E-24 mr1260_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 8.93E-07 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 4.27E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.17E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 4.21E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 6.62E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 5.94E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.28E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.33E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 4.63E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.58E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 4.25E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 7.32E-23 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.70E-13 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 1.79E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 9.78E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 5.55E-08 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 2.54E-19 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232697844 NA 4.36E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251