Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232693982:

Variant ID: vg0232693982 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32693982
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAACCGAACGCTAATACAGAGGGGAAAAAATCTAAACTAATCACGATACTAATCACGTTTCCTAATACAACCTAATTACCTAAACTAGCGCTAATCATG[A/G]
CGTTAATTATTTTTTAATTCTGATTTTAACCCTATGCGTAACGACGCGTGGTCTCCCCAGGCGAAAAAAAGCAAAAAAAAAAAAAAAGGAAACGATGGAC

Reverse complement sequence

GTCCATCGTTTCCTTTTTTTTTTTTTTTGCTTTTTTTCGCCTGGGGAGACCACGCGTCGTTACGCATAGGGTTAAAATCAGAATTAAAAAATAATTAACG[T/C]
CATGATTAGCGCTAGTTTAGGTAATTAGGTTGTATTAGGAAACGTGATTAGTATCGTGATTAGTTTAGATTTTTTCCCCTCTGTATTAGCGTTCGGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.60%	36.30%	0.13%	0.00%	NA
All Indica	2759	96.90%	2.90%	0.18%	0.00%	NA
All Japonica	1512	1.00%	99.00%	0.00%	0.00%	NA
Aus	269	72.50%	27.50%	0.00%	0.00%	NA
Indica I	595	99.30%	0.20%	0.50%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	97.40%	2.60%	0.00%	0.00%	NA
Indica Intermediate	786	94.00%	5.70%	0.25%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.00%	100.00%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	95.40%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232693982	A -> G	LOC_Os02g53420.1	upstream_gene_variant ; 938.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 96.222	N	N	N	N
vg0232693982	A -> G	LOC_Os02g53430.1	downstream_gene_variant ; 1397.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 96.222	N	N	N	N
vg0232693982	A -> G	LOC_Os02g53440.1	downstream_gene_variant ; 4898.0bp to feature; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 96.222	N	N	N	N
vg0232693982	A -> G	LOC_Os02g53420-LOC_Os02g53430	intergenic_region ; MODIFIER	silent_mutation	Average:63.621; most accessible tissue: Callus, score: 96.222	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232693982	NA	2.60E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	9.45E-14	mr1175	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	2.27E-32	mr1243	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	6.32E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	4.75E-17	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	4.35E-36	mr1435	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	5.31E-33	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	9.39E-28	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	6.12E-21	mr1689	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	6.01E-12	mr1744	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	2.91E-06	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	1.21E-38	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	3.05E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	1.57E-11	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	6.57E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	1.31E-36	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	1.86E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	5.61E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	8.20E-37	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982	NA	3.48E-15	mr1578_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251