\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232693982:

Variant ID: vg0232693982 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32693982
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAACCGAACGCTAATACAGAGGGGAAAAAATCTAAACTAATCACGATACTAATCACGTTTCCTAATACAACCTAATTACCTAAACTAGCGCTAATCATG[A/G]
CGTTAATTATTTTTTAATTCTGATTTTAACCCTATGCGTAACGACGCGTGGTCTCCCCAGGCGAAAAAAAGCAAAAAAAAAAAAAAAGGAAACGATGGAC

Reverse complement sequence

GTCCATCGTTTCCTTTTTTTTTTTTTTTGCTTTTTTTCGCCTGGGGAGACCACGCGTCGTTACGCATAGGGTTAAAATCAGAATTAAAAAATAATTAACG[T/C]
CATGATTAGCGCTAGTTTAGGTAATTAGGTTGTATTAGGAAACGTGATTAGTATCGTGATTAGTTTAGATTTTTTCCCCTCTGTATTAGCGTTCGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.60% 36.30% 0.13% 0.00% NA
All Indica  2759 96.90% 2.90% 0.18% 0.00% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 72.50% 27.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 94.00% 5.70% 0.25% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232693982 A -> G LOC_Os02g53420.1 upstream_gene_variant ; 938.0bp to feature; MODIFIER silent_mutation Average:63.621; most accessible tissue: Callus, score: 96.222 N N N N
vg0232693982 A -> G LOC_Os02g53430.1 downstream_gene_variant ; 1397.0bp to feature; MODIFIER silent_mutation Average:63.621; most accessible tissue: Callus, score: 96.222 N N N N
vg0232693982 A -> G LOC_Os02g53440.1 downstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:63.621; most accessible tissue: Callus, score: 96.222 N N N N
vg0232693982 A -> G LOC_Os02g53420-LOC_Os02g53430 intergenic_region ; MODIFIER silent_mutation Average:63.621; most accessible tissue: Callus, score: 96.222 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232693982 NA 2.60E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 9.45E-14 mr1175 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 2.27E-32 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 6.32E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 4.75E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 4.35E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 5.31E-33 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 9.39E-28 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 6.12E-21 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 6.01E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 2.91E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 1.21E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 3.05E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 1.57E-11 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 6.57E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 1.31E-36 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 1.86E-21 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 5.61E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 8.20E-37 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232693982 NA 3.48E-15 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251