\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232621709:

Variant ID: vg0232621709 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32621709
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


CGAATTACCCCCTAACACTGTTTTGAGCTGTTTTGACTGGGAGTTTGCACACGTGGCATCAACGTATCAATCCAGTCAGCAATAATAATAATAAATTTGT[G/A]
GGGTCCACCTATCATCTATTTCTTCTCTCTCTTAATCTTTCCTCTCCCCCGTCTCTTTCCCATTCTCTTCAGCTCGGGGTAGGCGTCGGCTGGACGGAGG

Reverse complement sequence

CCTCCGTCCAGCCGACGCCTACCCCGAGCTGAAGAGAATGGGAAAGAGACGGGGGAGAGGAAAGATTAAGAGAGAGAAGAAATAGATGATAGGTGGACCC[C/T]
ACAAATTTATTATTATTATTGCTGACTGGATTGATACGTTGATGCCACGTGTGCAAACTCCCAGTCAAAACAGCTCAAAACAGTGTTAGGGGGTAATTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 34.80% 0.08% 0.15% NA
All Indica  2759 96.80% 2.90% 0.11% 0.14% NA
All Japonica  1512 1.10% 98.90% 0.00% 0.07% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.34% 0.17% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 95.20% 4.60% 0.00% 0.22% NA
Indica Intermediate  786 96.60% 3.20% 0.13% 0.13% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 0.00% 100.00% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.00% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232621709 G -> A LOC_Os02g53290.1 upstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:70.42; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0232621709 G -> A LOC_Os02g53300.1 upstream_gene_variant ; 3917.0bp to feature; MODIFIER silent_mutation Average:70.42; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0232621709 G -> A LOC_Os02g53280-LOC_Os02g53290 intergenic_region ; MODIFIER silent_mutation Average:70.42; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N
vg0232621709 G -> DEL N N silent_mutation Average:70.42; most accessible tissue: Zhenshan97 panicle, score: 89.623 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0232621709 G A -0.05 -0.06 -0.05 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232621709 NA 6.68E-22 mr1020 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.46E-23 mr1021 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 6.88E-33 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.10E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 6.99E-12 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 2.63E-14 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 6.04E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.20E-23 mr1477 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.27E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 9.66E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.27E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 5.47E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 2.81E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 9.31E-10 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 3.18E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.11E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 5.48E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 8.52E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 9.96E-16 mr1578_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 1.61E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232621709 NA 2.17E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251