\
| Variant ID: vg0232556186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 32556186 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 227. )
AGGAGGGGTTTGGATGGGATAAAATTTTTAGCCCCTGTCACATCGAATGTTTAGACAATAATTAGAAGTATTGAACGTAGACTATTGATAAAACACATTC[C/T]
ATAACCCTGGACTAATTTGTGAGATAAACCTATTGAGCCTAATTAATTCATAATTAACCCATGTGATGCTACAATAAACATGTGCTAATTATGGATTAAT
ATTAATCCATAATTAGCACATGTTTATTGTAGCATCACATGGGTTAATTATGAATTAATTAGGCTCAATAGGTTTATCTCACAAATTAGTCCAGGGTTAT[G/A]
GAATGTGTTTTATCAATAGTCTACGTTCAATACTTCTAATTATTGTCTAAACATTCGATGTGACAGGGGCTAAAAATTTTATCCCATCCAAACCCCTCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 16.50% | 0.63% | 0.28% | NA |
| All Indica | 2759 | 96.80% | 3.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 55.40% | 42.10% | 1.59% | 0.86% | NA |
| Aus | 269 | 84.00% | 15.20% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.80% | 6.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 81.00% | 17.90% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 8.10% | 86.50% | 2.78% | 2.58% | NA |
| Japonica Intermediate | 241 | 73.00% | 26.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 18.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0232556186 | C -> T | LOC_Os02g53180.1 | upstream_gene_variant ; 2449.0bp to feature; MODIFIER | silent_mutation | Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0232556186 | C -> T | LOC_Os02g53180.2 | upstream_gene_variant ; 2450.0bp to feature; MODIFIER | silent_mutation | Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0232556186 | C -> T | LOC_Os02g53180.3 | upstream_gene_variant ; 2450.0bp to feature; MODIFIER | silent_mutation | Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0232556186 | C -> T | LOC_Os02g53169-LOC_Os02g53180 | intergenic_region ; MODIFIER | silent_mutation | Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0232556186 | C -> DEL | N | N | silent_mutation | Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0232556186 | NA | 4.88E-11 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 2.93E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | 4.54E-06 | 1.15E-09 | mr1321_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 6.41E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 8.34E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 8.06E-07 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 1.06E-06 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 2.39E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 6.18E-07 | mr1807_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0232556186 | NA | 5.64E-09 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |