\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232556186:

Variant ID: vg0232556186 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 32556186
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGGGGTTTGGATGGGATAAAATTTTTAGCCCCTGTCACATCGAATGTTTAGACAATAATTAGAAGTATTGAACGTAGACTATTGATAAAACACATTC[C/T]
ATAACCCTGGACTAATTTGTGAGATAAACCTATTGAGCCTAATTAATTCATAATTAACCCATGTGATGCTACAATAAACATGTGCTAATTATGGATTAAT

Reverse complement sequence

ATTAATCCATAATTAGCACATGTTTATTGTAGCATCACATGGGTTAATTATGAATTAATTAGGCTCAATAGGTTTATCTCACAAATTAGTCCAGGGTTAT[G/A]
GAATGTGTTTTATCAATAGTCTACGTTCAATACTTCTAATTATTGTCTAAACATTCGATGTGACAGGGGCTAAAAATTTTATCCCATCCAAACCCCTCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 16.50% 0.63% 0.28% NA
All Indica  2759 96.80% 3.10% 0.07% 0.00% NA
All Japonica  1512 55.40% 42.10% 1.59% 0.86% NA
Aus  269 84.00% 15.20% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 93.80% 6.10% 0.11% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 81.00% 17.90% 1.17% 0.00% NA
Tropical Japonica  504 8.10% 86.50% 2.78% 2.58% NA
Japonica Intermediate  241 73.00% 26.60% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0232556186 C -> T LOC_Os02g53180.1 upstream_gene_variant ; 2449.0bp to feature; MODIFIER silent_mutation Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0232556186 C -> T LOC_Os02g53180.2 upstream_gene_variant ; 2450.0bp to feature; MODIFIER silent_mutation Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0232556186 C -> T LOC_Os02g53180.3 upstream_gene_variant ; 2450.0bp to feature; MODIFIER silent_mutation Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0232556186 C -> T LOC_Os02g53169-LOC_Os02g53180 intergenic_region ; MODIFIER silent_mutation Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0232556186 C -> DEL N N silent_mutation Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0232556186 NA 4.88E-11 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 2.93E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 4.54E-06 1.15E-09 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 6.41E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 8.34E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 8.06E-07 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 1.06E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 2.39E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 6.18E-07 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186 NA 5.64E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251