Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0232556186:

Variant ID: vg0232556186 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 32556186
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGGAGGGGTTTGGATGGGATAAAATTTTTAGCCCCTGTCACATCGAATGTTTAGACAATAATTAGAAGTATTGAACGTAGACTATTGATAAAACACATTC[C/T]
ATAACCCTGGACTAATTTGTGAGATAAACCTATTGAGCCTAATTAATTCATAATTAACCCATGTGATGCTACAATAAACATGTGCTAATTATGGATTAAT

Reverse complement sequence

ATTAATCCATAATTAGCACATGTTTATTGTAGCATCACATGGGTTAATTATGAATTAATTAGGCTCAATAGGTTTATCTCACAAATTAGTCCAGGGTTAT[G/A]
GAATGTGTTTTATCAATAGTCTACGTTCAATACTTCTAATTATTGTCTAAACATTCGATGTGACAGGGGCTAAAAATTTTATCCCATCCAAACCCCTCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.60%	16.50%	0.63%	0.28%	NA
All Indica	2759	96.80%	3.10%	0.07%	0.00%	NA
All Japonica	1512	55.40%	42.10%	1.59%	0.86%	NA
Aus	269	84.00%	15.20%	0.74%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	93.80%	6.10%	0.11%	0.00%	NA
Indica Intermediate	786	97.50%	2.40%	0.13%	0.00%	NA
Temperate Japonica	767	81.00%	17.90%	1.17%	0.00%	NA
Tropical Japonica	504	8.10%	86.50%	2.78%	2.58%	NA
Japonica Intermediate	241	73.00%	26.60%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0232556186	C -> T	LOC_Os02g53180.1	upstream_gene_variant ; 2449.0bp to feature; MODIFIER	silent_mutation	Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0232556186	C -> T	LOC_Os02g53180.2	upstream_gene_variant ; 2450.0bp to feature; MODIFIER	silent_mutation	Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0232556186	C -> T	LOC_Os02g53180.3	upstream_gene_variant ; 2450.0bp to feature; MODIFIER	silent_mutation	Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0232556186	C -> T	LOC_Os02g53169-LOC_Os02g53180	intergenic_region ; MODIFIER	silent_mutation	Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0232556186	C -> DEL	N	N	silent_mutation	Average:46.622; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0232556186	NA	4.88E-11	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	2.93E-07	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	4.54E-06	1.15E-09	mr1321_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	6.41E-06	mr1321_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	8.34E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	8.06E-07	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	1.06E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	2.39E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	6.18E-07	mr1807_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0232556186	NA	5.64E-09	mr1991_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251